2010 |
Proton hyperpolarisation preserved in long-lived states Article de journal P Ahuja; R Sarkar; S Jannin; P R Vasos; G Bodenhausen Chemical Communications, 46 (43), p. 8192–8194, 2010. @article{Ahuja:2010, title = {Proton hyperpolarisation preserved in long-lived states}, author = {P Ahuja and R Sarkar and S Jannin and P R Vasos and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-77958464801&doi=10.1039%2fc0cc01953d&partnerID=40&md5=aeb3c2b7112e24571c6e0df1ad773bca}, doi = {10.1039/c0cc01953d}, year = {2010}, date = {2010-01-01}, journal = {Chemical Communications}, volume = {46}, number = {43}, pages = {8192--8194}, abstract = {The polarisation of abundant protons, rather than dilute nuclei with low gyromagnetic ratios, can be enhanced in less than 10 min using dissolution DNP and converted into a long-lived state delocalised over an ensemble of three coupled protons. The process is more straightforward than the hyperpolarisation of heteronuclei followed by magnetisation transfer to protons. © 2010 The Royal Society of Chemistry.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The polarisation of abundant protons, rather than dilute nuclei with low gyromagnetic ratios, can be enhanced in less than 10 min using dissolution DNP and converted into a long-lived state delocalised over an ensemble of three coupled protons. The process is more straightforward than the hyperpolarisation of heteronuclei followed by magnetisation transfer to protons. © 2010 The Royal Society of Chemistry. |
Scavenging free radicals to preserve enhancement and extend relaxation times in NMR using dynamic nuclear polarization Article de journal P Miéville; P Ahuja; R Sarkar; S Jannin; P R Vasos; S Gerber-Lemaire; M Mishkovsky; A Comment; R Gruetter; O Ouari; P Tordo; G Bodenhausen Angewandte Chemie - International Edition, 49 (35), p. 6182–6185, 2010. @article{Mieville:2010a, title = {Scavenging free radicals to preserve enhancement and extend relaxation times in NMR using dynamic nuclear polarization}, author = {P Mi\'{e}ville and P Ahuja and R Sarkar and S Jannin and P R Vasos and S Gerber-Lemaire and M Mishkovsky and A Comment and R Gruetter and O Ouari and P Tordo and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-77956050868&doi=10.1002%2fanie.201000934&partnerID=40&md5=f87c9bbf5831825ce6661a313d54bf12}, doi = {10.1002/anie.201000934}, year = {2010}, date = {2010-01-01}, journal = {Angewandte Chemie - International Edition}, volume = {49}, number = {35}, pages = {6182--6185}, abstract = {Vitamin C for longer lifetimes: N-oxide radicals that are widely used for dynamic nuclear polarization can be reduced by scavengers such as sodium ascorbate (vitamin C) during the dissolution process, thus diminishing losses of polarization during the transfer and extending transverse and longitudinal relaxation times in NMR spectroscopy (see picture). © 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Vitamin C for longer lifetimes: N-oxide radicals that are widely used for dynamic nuclear polarization can be reduced by scavengers such as sodium ascorbate (vitamin C) during the dissolution process, thus diminishing losses of polarization during the transfer and extending transverse and longitudinal relaxation times in NMR spectroscopy (see picture). © 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim. |
2009 |
Accurate sampling of high-frequency motions in proteins by steady-state 15N- 1H nuclear overhauser effect measurements in the presence of cross-correlated relaxation Article de journal F Ferrage; D Cowburn; R Ghose Journal of the American Chemical Society, 131 (17), p. 6048–6049, 2009. @article{Ferrage:2009, title = {Accurate sampling of high-frequency motions in proteins by steady-state 15N- 1H nuclear overhauser effect measurements in the presence of cross-correlated relaxation}, author = {F Ferrage and D Cowburn and R Ghose}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-70149102207&doi=10.1021%2fja809526q&partnerID=40&md5=e6329f323be9139dc9415da63eaddad2}, doi = {10.1021/ja809526q}, year = {2009}, date = {2009-01-01}, journal = {Journal of the American Chemical Society}, volume = {131}, number = {17}, pages = {6048--6049}, abstract = {The steady-state 1H- 15N NOE experiment is used in most common NMR analyses of backbone dynamics to accurately ascertain the effects of the fast dynamic modes. We demonstrate here that, in its most common implementation, this experiment generates an incorrect steady state in the presence of CSA/dipole cross-correlated relaxation leading to large errors in the characterization of these high-frequency modes. This affects both the quantitative and qualitative interpretation of 15N backbone relaxation in dynamic terms. We demonstrate further that minor changes in the experimental implementation effectively remove these errors and allow a more accurate interpretation of protein backbone dynamics. © 2009 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The steady-state 1H- 15N NOE experiment is used in most common NMR analyses of backbone dynamics to accurately ascertain the effects of the fast dynamic modes. We demonstrate here that, in its most common implementation, this experiment generates an incorrect steady state in the presence of CSA/dipole cross-correlated relaxation leading to large errors in the characterization of these high-frequency modes. This affects both the quantitative and qualitative interpretation of 15N backbone relaxation in dynamic terms. We demonstrate further that minor changes in the experimental implementation effectively remove these errors and allow a more accurate interpretation of protein backbone dynamics. © 2009 American Chemical Society. |
Diffusion coefficients of biomolecules using long-lived spin states Article de journal P Ahuja; R Sarkar; P R Vasos; G Bodenhausen Journal of the American Chemical Society, 131 (22), p. 7498–7499, 2009. @article{Ahuja:2009, title = {Diffusion coefficients of biomolecules using long-lived spin states}, author = {P Ahuja and R Sarkar and P R Vasos and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-67650555695&doi=10.1021%2fja902030k&partnerID=40&md5=d132b1729e8f348534a427c3c2508fbb}, doi = {10.1021/ja902030k}, year = {2009}, date = {2009-01-01}, journal = {Journal of the American Chemical Society}, volume = {131}, number = {22}, pages = {7498--7499}, abstract = {(Graph Presented) We report the first observation of long-lived states (LLS) having lifetimes TLLS that exceed the corresponding spin?lattice relaxation times T1 by more than a factor 6 in a protein. Slow diffusion coefficients characteristic of large biomolecules can be determined by combining LLS methods with moderate pulsed field gradients (PFGs) available on commercial probeheads, as the extension of spin memory reduces the strain on the duration and/or strength of the PFGs. No isotope labeling of the biomolecule is necessary. Copyright © 2009 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } (Graph Presented) We report the first observation of long-lived states (LLS) having lifetimes TLLS that exceed the corresponding spin?lattice relaxation times T1 by more than a factor 6 in a protein. Slow diffusion coefficients characteristic of large biomolecules can be determined by combining LLS methods with moderate pulsed field gradients (PFGs) available on commercial probeheads, as the extension of spin memory reduces the strain on the duration and/or strength of the PFGs. No isotope labeling of the biomolecule is necessary. Copyright © 2009 American Chemical Society. |
Cross-encoded magnetic resonance imaging in inhomogeneous fields Article de journal R Paquin; P Pelupessy; G Bodenhausen Journal of Magnetic Resonance, 201 (2), p. 199–204, 2009. @article{Paquin:2009, title = {Cross-encoded magnetic resonance imaging in inhomogeneous fields}, author = {R Paquin and P Pelupessy and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-70350617669&doi=10.1016%2fj.jmr.2009.09.008&partnerID=40&md5=fcdf5b04bd828d83f39f8ad928661723}, doi = {10.1016/j.jmr.2009.09.008}, year = {2009}, date = {2009-01-01}, journal = {Journal of Magnetic Resonance}, volume = {201}, number = {2}, pages = {199--204}, abstract = {In magnetic resonance imaging (MRI), it is possible to cancel the effects of severe inhomogeneities of the magnetic field even if the field profile is unknown. The new 'cross-encoded' method is based on adiabatic frequency-modulated pulses combined with two orthogonal gradients that are applied simultaneously during encoding and decoding. Undistorted two- and three-dimensional images can be obtained in inhomogeneous fields where the breadth of the water resonance extends over several kHz. © 2009 Elsevier Inc. All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } In magnetic resonance imaging (MRI), it is possible to cancel the effects of severe inhomogeneities of the magnetic field even if the field profile is unknown. The new 'cross-encoded' method is based on adiabatic frequency-modulated pulses combined with two orthogonal gradients that are applied simultaneously during encoding and decoding. Undistorted two- and three-dimensional images can be obtained in inhomogeneous fields where the breadth of the water resonance extends over several kHz. © 2009 Elsevier Inc. All rights reserved. |
Apparent transverse relaxation rates in systems with scalar-coupled protons Article de journal B Baishya; T F Segawa; G Bodenhausen Journal of the American Chemical Society, 131 (48), p. 17538–17539, 2009. @article{Baishya:2009, title = {Apparent transverse relaxation rates in systems with scalar-coupled protons}, author = {B Baishya and T F Segawa and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-72249087946&doi=10.1021%2fja907391z&partnerID=40&md5=375ae998e7607d62efdaccc51315bf70}, doi = {10.1021/ja907391z}, year = {2009}, date = {2009-01-01}, journal = {Journal of the American Chemical Society}, volume = {131}, number = {48}, pages = {17538--17539}, abstract = {(Graph Presented) The modulation of spin echoes by homonuclear scalar couplings render the determination of transverse relaxation rates of individual spins difficult, in particular for molecules that are isotopically enriched in 13C or 15N, and for all molecules with scalar-coupled protons. To avoid echo modulations, most studies using refocusing pulses have so far been restricted to isolated 1H, 13C, or 15N spins. We report measurements of apparent 1H transverse relaxation rates of backbone and side-chain protons in Cyclosporin A (CsA) determined by quenching the echo modulations that arise from homonuclear scalar couplings between protons. © 2009 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } (Graph Presented) The modulation of spin echoes by homonuclear scalar couplings render the determination of transverse relaxation rates of individual spins difficult, in particular for molecules that are isotopically enriched in 13C or 15N, and for all molecules with scalar-coupled protons. To avoid echo modulations, most studies using refocusing pulses have so far been restricted to isolated 1H, 13C, or 15N spins. We report measurements of apparent 1H transverse relaxation rates of backbone and side-chain protons in Cyclosporin A (CsA) determined by quenching the echo modulations that arise from homonuclear scalar couplings between protons. © 2009 American Chemical Society. |
Broadband carbon-13 correlation spectra of microcrystalline proteins in very high magnetic fields Article de journal M Weingarth; G Bodenhausen; P Tekely Journal of the American Chemical Society, 131 (39), p. 13937–13939, 2009. @article{Weingarth:2009, title = {Broadband carbon-13 correlation spectra of microcrystalline proteins in very high magnetic fields}, author = {M Weingarth and G Bodenhausen and P Tekely}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-70349628873&doi=10.1021%2fja9036143&partnerID=40&md5=2c2d3bd587ce8a4bb0d066f8031d286f}, doi = {10.1021/ja9036143}, year = {2009}, date = {2009-01-01}, journal = {Journal of the American Chemical Society}, volume = {131}, number = {39}, pages = {13937--13939}, abstract = {(Figure Presented) PARIS recoupling irradiation, despite a low rf amplitude, can promote efficient magnetization transfer during solid-state NMR experiments at 900 MHz over a wide range of differences in isotropic chemical shifts in microcrystalline proteins. © 2009 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } (Figure Presented) PARIS recoupling irradiation, despite a low rf amplitude, can promote efficient magnetization transfer during solid-state NMR experiments at 900 MHz over a wide range of differences in isotropic chemical shifts in microcrystalline proteins. © 2009 American Chemical Society. |
High-resolution NMR in magnetic fields with unknown spatiotemporal variations Article de journal P Pelupessy; E Rennella; G Bodenhausen Science, 324 (5935), p. 1693–1697, 2009. @article{Pelupessy:2009, title = {High-resolution NMR in magnetic fields with unknown spatiotemporal variations}, author = {P Pelupessy and E Rennella and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-67649961132&doi=10.1126%2fscience.1175102&partnerID=40&md5=724b5c6d55e64f292bd0a0fd438470b9}, doi = {10.1126/science.1175102}, year = {2009}, date = {2009-01-01}, journal = {Science}, volume = {324}, number = {5935}, pages = {1693--1697}, abstract = {Nuclear magnetic resonance (NMR) experiments are usually carried out in homogeneous magnetic fields. In many cases, however, high-resolution spectra are virtually impossible to obtain because of the inherent heterogeneity of the samples or living organisms under investigation, as well as the poor homogeneity of the magnets (particularly when bulky samples must be placed outside their bores). Unstable power supplies and vibrations arising from cooling can lead to field fluctuations in time as well as space. We show how high-resolution NMR spectra can be obtained in inhomogeneous fields with unknown spatiotemporal variations. Our method, based on coherence transfer between spins, can accommodate spatial inhomogeneities of at least 11 gauss per centimeter and temporal fluctuations slower than 2 hertz.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Nuclear magnetic resonance (NMR) experiments are usually carried out in homogeneous magnetic fields. In many cases, however, high-resolution spectra are virtually impossible to obtain because of the inherent heterogeneity of the samples or living organisms under investigation, as well as the poor homogeneity of the magnets (particularly when bulky samples must be placed outside their bores). Unstable power supplies and vibrations arising from cooling can lead to field fluctuations in time as well as space. We show how high-resolution NMR spectra can be obtained in inhomogeneous fields with unknown spatiotemporal variations. Our method, based on coherence transfer between spins, can accommodate spatial inhomogeneities of at least 11 gauss per centimeter and temporal fluctuations slower than 2 hertz. |
Improved magnetization transfer in solid-state NMR with fast magic angle spinning Article de journal M Weingarth; D E Demco; G Bodenhausen; P Tekely Chemical Physics Letters, 469 (4-6), p. 342–348, 2009. @article{Weingarth:2009a, title = {Improved magnetization transfer in solid-state NMR with fast magic angle spinning}, author = {M Weingarth and D E Demco and G Bodenhausen and P Tekely}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-59249083023&doi=10.1016%2fj.cplett.2008.12.084&partnerID=40&md5=e4993820258563f66b1dc745883406f2}, doi = {10.1016/j.cplett.2008.12.084}, year = {2009}, date = {2009-01-01}, journal = {Chemical Physics Letters}, volume = {469}, number = {4-6}, pages = {342--348}, abstract = {The efficiency of magnetization transfer between different spins S such as chemically inequivalent carbon-13 nuclei in solid samples that are spinning at high frequencies about the magic angle can be enhanced by a phase-alternated recoupling irradiation scheme (PARIS). Dipolar recoupling is assisted by a radio-frequency (rf) field applied to the abundant I (proton) spins. In contrast to rotary resonance-based recoupling schemes, the new method does not depend critically on the rf amplitude, which need not be matched with the spinning frequency. Modest rf amplitudes suffice to bring about efficient magnetization transfer even at high spinning speeds, thus avoiding excessive sample heating. The new method compensates efficiently for rf field inhomogeneity, so that the full sample volume is used more effectively. © 2008 Elsevier B.V. All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The efficiency of magnetization transfer between different spins S such as chemically inequivalent carbon-13 nuclei in solid samples that are spinning at high frequencies about the magic angle can be enhanced by a phase-alternated recoupling irradiation scheme (PARIS). Dipolar recoupling is assisted by a radio-frequency (rf) field applied to the abundant I (proton) spins. In contrast to rotary resonance-based recoupling schemes, the new method does not depend critically on the rf amplitude, which need not be matched with the spinning frequency. Modest rf amplitudes suffice to bring about efficient magnetization transfer even at high spinning speeds, thus avoiding excessive sample heating. The new method compensates efficiently for rf field inhomogeneity, so that the full sample volume is used more effectively. © 2008 Elsevier B.V. All rights reserved. |
Low-power decoupling at high spinning frequencies in high static fields Article de journal M Weingarth; G Bodenhausen; P Tekely Journal of Magnetic Resonance, 199 (2), p. 238–241, 2009. @article{Weingarth:2009b, title = {Low-power decoupling at high spinning frequencies in high static fields}, author = {M Weingarth and G Bodenhausen and P Tekely}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-67649416468&doi=10.1016%2fj.jmr.2009.04.015&partnerID=40&md5=7bf142baa0adcc03289a9946d2bab295}, doi = {10.1016/j.jmr.2009.04.015}, year = {2009}, date = {2009-01-01}, journal = {Journal of Magnetic Resonance}, volume = {199}, number = {2}, pages = {238--241}, abstract = {We demonstrate that heteronuclear decoupling using a Phase-Inverted Supercycled Sequence for Attenuation of Rotary ResOnance (PISSARRO) is very efficient at high spinning frequencies (νrot = 60 kHz) and high magnetic fields (900 MHz for protons at 21 T) even with moderate radio-frequency decoupling amplitudes (ν1I = 15 kHz), despite the wide range of isotropic chemical shifts of the protons and the increased effect of their chemical shift anisotropy. © 2009 Elsevier Inc. All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } We demonstrate that heteronuclear decoupling using a Phase-Inverted Supercycled Sequence for Attenuation of Rotary ResOnance (PISSARRO) is very efficient at high spinning frequencies (νrot = 60 kHz) and high magnetic fields (900 MHz for protons at 21 T) even with moderate radio-frequency decoupling amplitudes (ν1I = 15 kHz), despite the wide range of isotropic chemical shifts of the protons and the increased effect of their chemical shift anisotropy. © 2009 Elsevier Inc. All rights reserved. |
Long-lived states in multiple-spin systems Article de journal P Ahuja; R Sarkar; P R Vasos; G Bodenhausen ChemPhysChem, 10 (13), p. 2217–2220, 2009. @article{Ahuja:2009a, title = {Long-lived states in multiple-spin systems}, author = {P Ahuja and R Sarkar and P R Vasos and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-69949132897&doi=10.1002%2fcphc.200900335&partnerID=40&md5=0e79becb3dceb08f1fc03020c29972e8}, doi = {10.1002/cphc.200900335}, year = {2009}, date = {2009-01-01}, journal = {ChemPhysChem}, volume = {10}, number = {13}, pages = {2217--2220}, keywords = {}, pubstate = {published}, tppubtype = {article} } |
Generating spin turbulence through nonlinear excitation in liquid-state NMR Article de journal D Abergel; A Louis-Joseph Journal of Magnetic Resonance, 196 (2), p. 115–118, 2009. @article{Abergel:2009, title = {Generating spin turbulence through nonlinear excitation in liquid-state NMR}, author = {D Abergel and A Louis-Joseph}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-58249142085&doi=10.1016%2fj.jmr.2008.10.016&partnerID=40&md5=5f7fbd1140dbb405ff54068d9123f997}, doi = {10.1016/j.jmr.2008.10.016}, year = {2009}, date = {2009-01-01}, journal = {Journal of Magnetic Resonance}, volume = {196}, number = {2}, pages = {115--118}, abstract = {Chaotic dynamics of a water magnetization in a 600 MHz NMR spectrometer was generated by a radiation damping-based electronic feedback. Erratic induction signal was observed for several tens of seconds. The analysis of the data shows that this chaotic behaviour can be ascribed to spin turbulence in the sample and that a simpler model based on the three-dimensional Bloch equations modified to include a feedback field may not account for the experimental data. © 2008 Elsevier Inc. All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Chaotic dynamics of a water magnetization in a 600 MHz NMR spectrometer was generated by a radiation damping-based electronic feedback. Erratic induction signal was observed for several tens of seconds. The analysis of the data shows that this chaotic behaviour can be ascribed to spin turbulence in the sample and that a simpler model based on the three-dimensional Bloch equations modified to include a feedback field may not account for the experimental data. © 2008 Elsevier Inc. All rights reserved. |
2008 |
Towards the prediction of NMR relaxation rates in proteins from their structure by a network of coupled rotators Article de journal G Nodet; G Bodenhausen; D Abergel Comptes Rendus Chimie, 11 (4-5), p. 524–529, 2008. @article{Nodet:2008a, title = {Towards the prediction of NMR relaxation rates in proteins from their structure by a network of coupled rotators}, author = {G Nodet and G Bodenhausen and D Abergel}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-41349091032&doi=10.1016%2fj.crci.2007.08.008&partnerID=40&md5=af84035a22030682aa765e8c936643c8}, doi = {10.1016/j.crci.2007.08.008}, year = {2008}, date = {2008-01-01}, journal = {Comptes Rendus Chimie}, volume = {11}, number = {4-5}, pages = {524--529}, abstract = {During the past decades, NMR spectroscopy of isotopically labelled proteins has emerged as a unique tool for the study of internal protein dynamics in solution. The possibility of measuring spin relaxation rates in proteins has motivated numerous theoretical and methodological developments aiming at the interpretation and the prediction of their internal dynamics. In this article, we discuss the possibility of predicting 15N relaxation rates using a Network of Coupled Rotators to describe internal motions of a protein starting from its three-dimensional structure, and illustrate the approach by the example of the protein calbindin. © 2007 Acad\'{e}mie des sciences.}, keywords = {}, pubstate = {published}, tppubtype = {article} } During the past decades, NMR spectroscopy of isotopically labelled proteins has emerged as a unique tool for the study of internal protein dynamics in solution. The possibility of measuring spin relaxation rates in proteins has motivated numerous theoretical and methodological developments aiming at the interpretation and the prediction of their internal dynamics. In this article, we discuss the possibility of predicting 15N relaxation rates using a Network of Coupled Rotators to describe internal motions of a protein starting from its three-dimensional structure, and illustrate the approach by the example of the protein calbindin. © 2007 Académie des sciences. |
Broadband dipolar recoupling for magnetization transfer in solid-state NMR correlation spectroscopy Article de journal L Duma; D Abergel; F Ferrage; P Pelupessy; P Tekely; G Bodenhausen ChemPhysChem, 9 (8), p. 1104–1106, 2008. @article{Duma:2008, title = {Broadband dipolar recoupling for magnetization transfer in solid-state NMR correlation spectroscopy}, author = {L Duma and D Abergel and F Ferrage and P Pelupessy and P Tekely and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-45249097635&doi=10.1002%2fcphc.200800053&partnerID=40&md5=66d336ed908539f86a0a55977ae0ed7c}, doi = {10.1002/cphc.200800053}, year = {2008}, date = {2008-01-01}, journal = {ChemPhysChem}, volume = {9}, number = {8}, pages = {1104--1106}, abstract = {Efficient recoupling: A new experimental procedure using a broadband variant of rotary resonance recoupling (B2R3, see figure) improves 13C-13C transfer of magnetization in biological molecules. (Chemical Equation Presented) The robustness of the method, combined with its simplicity, results in improved structural analysis of crystalline and non-crystalline systems. © 2008 Wiley-VCH Verlag GmbH & Co. KGaA.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Efficient recoupling: A new experimental procedure using a broadband variant of rotary resonance recoupling (B2R3, see figure) improves 13C-13C transfer of magnetization in biological molecules. (Chemical Equation Presented) The robustness of the method, combined with its simplicity, results in improved structural analysis of crystalline and non-crystalline systems. © 2008 Wiley-VCH Verlag GmbH & Co. KGaA. |
Multiple-timescale dynamics of side-chain carboxyl and carbonyl groups in proteins by 13C nuclear spin relaxation Article de journal R Paquin; F Ferrage; F A A Mulder; M Akke; G Bodenhausen Journal of the American Chemical Society, 130 (47), p. 15805–15807, 2008. @article{Paquin:2008, title = {Multiple-timescale dynamics of side-chain carboxyl and carbonyl groups in proteins by 13C nuclear spin relaxation}, author = {R Paquin and F Ferrage and F A A Mulder and M Akke and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-56749180963&doi=10.1021%2fja803794g&partnerID=40&md5=74ae027f848a9bf016b4b0de7dbc439f}, doi = {10.1021/ja803794g}, year = {2008}, date = {2008-01-01}, journal = {Journal of the American Chemical Society}, volume = {130}, number = {47}, pages = {15805--15807}, abstract = {Side-chain carboxyl and carbonyl groups play a major role in protein interactions and enzyme catalysis. A series of 13C relaxation experiments is introduced to study the dynamics of carboxyl and carbonyl groups in protein side chains on both fast (sub-ns) and slower (μs-ms) time scales. This approach is illustrated on the protein calbindin D9k. Fast dynamics features correlate with hydrogen- and ion-binding patterns. We also identify chemical dynamics on μs time scales in solvent-exposed carboxyl groups, most probably due to exchange between the carboxylate and carboxylic acid forms. Copyright © 2008 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Side-chain carboxyl and carbonyl groups play a major role in protein interactions and enzyme catalysis. A series of 13C relaxation experiments is introduced to study the dynamics of carboxyl and carbonyl groups in protein side chains on both fast (sub-ns) and slower (μs-ms) time scales. This approach is illustrated on the protein calbindin D9k. Fast dynamics features correlate with hydrogen- and ion-binding patterns. We also identify chemical dynamics on μs time scales in solvent-exposed carboxyl groups, most probably due to exchange between the carboxylate and carboxylic acid forms. Copyright © 2008 American Chemical Society. |
On the measurement of 15N-1H nuclear Overhauser effects Article de journal F Ferrage; A Piserchio; D Cowburn; R Ghose Journal of Magnetic Resonance, 192 (2), p. 302–313, 2008. @article{Ferrage:2008, title = {On the measurement of 15N-1H nuclear Overhauser effects}, author = {F Ferrage and A Piserchio and D Cowburn and R Ghose}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-43949104379&doi=10.1016%2fj.jmr.2008.03.011&partnerID=40&md5=6ab29f9e3c7f7ed1e5f5d0dfe20b7788}, doi = {10.1016/j.jmr.2008.03.011}, year = {2008}, date = {2008-01-01}, journal = {Journal of Magnetic Resonance}, volume = {192}, number = {2}, pages = {302--313}, abstract = {Accurate quantification of the 15N-1H steady-state NOE is central to current methods for the elucidation of protein backbone dynamics on the fast, sub-nanosecond time scale. This experiment is highly susceptible to systematic errors arising from multiple sources. The nature of these errors and their effects on the determined NOE ratio is evaluated by a detailed analysis of the spin dynamics during the pair of experiments used to measure this ratio and possible improvements suggested. The experiment that includes 1H irradiation, is analyzed in the framework of Average Liouvillian Theory and a modified saturation scheme that generates a stable steady-state and eliminates the need to completely saturate 1H nuclei is presented. The largest source of error, however, in 1H-dilute systems at ultra-high fields is found to be an overestimation of the steady-state NOE value as a consequence of the incomplete equilibration of the magnetization in the so-called "reference experiment". The use of very long relaxation delays is usually an effective, but time consuming, solution. Here, we introduce an alternative reference experiment, designed for larger, deuterated systems, that uses the fastest relaxing component of the longitudinal magnetization as a closer approximation to the equilibrium state for shorter relaxation delays. The utility of the modified approach is illustrated through simulations on realistic spin systems over a wide range of time scales and experimentally verified using a perdeuterated sample of human ubiquitin. © 2008 Elsevier Inc. All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Accurate quantification of the 15N-1H steady-state NOE is central to current methods for the elucidation of protein backbone dynamics on the fast, sub-nanosecond time scale. This experiment is highly susceptible to systematic errors arising from multiple sources. The nature of these errors and their effects on the determined NOE ratio is evaluated by a detailed analysis of the spin dynamics during the pair of experiments used to measure this ratio and possible improvements suggested. The experiment that includes 1H irradiation, is analyzed in the framework of Average Liouvillian Theory and a modified saturation scheme that generates a stable steady-state and eliminates the need to completely saturate 1H nuclei is presented. The largest source of error, however, in 1H-dilute systems at ultra-high fields is found to be an overestimation of the steady-state NOE value as a consequence of the incomplete equilibration of the magnetization in the so-called "reference experiment". The use of very long relaxation delays is usually an effective, but time consuming, solution. Here, we introduce an alternative reference experiment, designed for larger, deuterated systems, that uses the fastest relaxing component of the longitudinal magnetization as a closer approximation to the equilibrium state for shorter relaxation delays. The utility of the modified approach is illustrated through simulations on realistic spin systems over a wide range of time scales and experimentally verified using a perdeuterated sample of human ubiquitin. © 2008 Elsevier Inc. All rights reserved. |
Single or triple gradients? Article de journal R Sarkar; D Moskau; F Ferrage; P R Vasos; G Bodenhausen Journal of Magnetic Resonance, 193 (1), p. 110–118, 2008. @article{Sarkar:2008a, title = {Single or triple gradients?}, author = {R Sarkar and D Moskau and F Ferrage and P R Vasos and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-44649116396&doi=10.1016%2fj.jmr.2008.04.029&partnerID=40&md5=4f3d92f0bf0f0aaf5cc559e8ffdbf964}, doi = {10.1016/j.jmr.2008.04.029}, year = {2008}, date = {2008-01-01}, journal = {Journal of Magnetic Resonance}, volume = {193}, number = {1}, pages = {110--118}, abstract = {Pulsed Field Gradients (PFGs) have become ubiquitous tools not only for Magnetic Resonance Imaging (MRI), but also for NMR experiments designed to study translational diffusion, for spatial encoding in ultra-fast spectroscopy, for the selection of desirable coherence transfer pathways, for the suppression of solvent signals, and for the elimination of zero-quantum coherences. Some of these experiments can only be carried out if three orthogonal gradients are available, while others can also be implemented using a single gradient, albeit at some expense of performance. This paper discusses some of the advantages of triple- with respect to single-gradient probes. By way of examples we discuss (i) the measurement of small diffusion coefficients making use of the long spin-lattice relaxation times of nuclei with low gyromagnetic ratios γ such as nitrogen-15, and (ii) the elimination of zero-quantum coherences in Exchange or Nuclear Overhauser Spectroscopy (EXSY or NOESY) experiments, as well as in methods relying on long-lived (singlet) states to study very slow exchange or diffusion processes. © 2008 Elsevier Inc. All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Pulsed Field Gradients (PFGs) have become ubiquitous tools not only for Magnetic Resonance Imaging (MRI), but also for NMR experiments designed to study translational diffusion, for spatial encoding in ultra-fast spectroscopy, for the selection of desirable coherence transfer pathways, for the suppression of solvent signals, and for the elimination of zero-quantum coherences. Some of these experiments can only be carried out if three orthogonal gradients are available, while others can also be implemented using a single gradient, albeit at some expense of performance. This paper discusses some of the advantages of triple- with respect to single-gradient probes. By way of examples we discuss (i) the measurement of small diffusion coefficients making use of the long spin-lattice relaxation times of nuclei with low gyromagnetic ratios γ such as nitrogen-15, and (ii) the elimination of zero-quantum coherences in Exchange or Nuclear Overhauser Spectroscopy (EXSY or NOESY) experiments, as well as in methods relying on long-lived (singlet) states to study very slow exchange or diffusion processes. © 2008 Elsevier Inc. All rights reserved. |
Coherence transfer between spy nuclei and nitrogen-14 in solids Article de journal S Cavadini; A Abraham; G Bodenhausen Journal of Magnetic Resonance, 190 (1), p. 160–164, 2008. @article{Cavadini:2008, title = {Coherence transfer between spy nuclei and nitrogen-14 in solids}, author = {S Cavadini and A Abraham and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-36849069439&doi=10.1016%2fj.jmr.2007.10.008&partnerID=40&md5=c76dd0d608811d2585808ed9043eb200}, doi = {10.1016/j.jmr.2007.10.008}, year = {2008}, date = {2008-01-01}, journal = {Journal of Magnetic Resonance}, volume = {190}, number = {1}, pages = {160--164}, abstract = {Coherence transfer from 'spy nuclei' such as 1H or 13C (S = 1/2) was used to excite single- or double-quantum coherences of 14N nuclei (I = 1) while the S spins were aligned along the static field, in the manner of heteronuclear single-quantum correlation (HSQC) spectroscopy. For samples spinning at the magic angle, coherence transfer can be achieved through a combination of scalar couplings J(I, S) and second-order quadrupole-dipole cross-terms, also known as residual dipolar splittings (RDS). The second-order quadrupolar powder patterns in the two-dimensional spectra allow one to determine the quadrupolar parameters of 14N in amino acids. © 2007 Elsevier Inc. All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Coherence transfer from 'spy nuclei' such as 1H or 13C (S = 1/2) was used to excite single- or double-quantum coherences of 14N nuclei (I = 1) while the S spins were aligned along the static field, in the manner of heteronuclear single-quantum correlation (HSQC) spectroscopy. For samples spinning at the magic angle, coherence transfer can be achieved through a combination of scalar couplings J(I, S) and second-order quadrupole-dipole cross-terms, also known as residual dipolar splittings (RDS). The second-order quadrupolar powder patterns in the two-dimensional spectra allow one to determine the quadrupolar parameters of 14N in amino acids. © 2007 Elsevier Inc. All rights reserved. |
America, America! Article de journal A Molinié; G Bodenhausen Chimia, 62 (4), p. 291–299, 2008. @article{Molinie:2008, title = {America, America!}, author = {A Molini\'{e} and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-44349193413&doi=10.2533%2fchimia.2008.291&partnerID=40&md5=88f505a1d8ae7bc02f3840671dbbd9e8}, doi = {10.2533/chimia.2008.291}, year = {2008}, date = {2008-01-01}, journal = {Chimia}, volume = {62}, number = {4}, pages = {291--299}, abstract = {This account was written during a four-month stay in Berkeley from May to August 2007. It was partly inspired by a diary published by Simone de Beauvoir after her four-month lecture tour to the US in 1947. [1] We could not resist the temptation of writing a few pages about our impressions. This text is not intended as an essay about anthropological or chemical sciences. We merely tried to understand the conditions of the bubbling creativity that we have so often witnessed in Berkeley. Some of our comments are more or less voluntarily na\"{i}ve, as if Voltaire's Candide had made a trip to America. Our impressions may appear a bit franchouillardes, and perhaps a trifle rude to our American hosts, whose kindness does not deserve such a harsh treatment. © Schweizerische Chemische Gesellschaft.}, keywords = {}, pubstate = {published}, tppubtype = {article} } This account was written during a four-month stay in Berkeley from May to August 2007. It was partly inspired by a diary published by Simone de Beauvoir after her four-month lecture tour to the US in 1947. [1] We could not resist the temptation of writing a few pages about our impressions. This text is not intended as an essay about anthropological or chemical sciences. We merely tried to understand the conditions of the bubbling creativity that we have so often witnessed in Berkeley. Some of our comments are more or less voluntarily naïve, as if Voltaire's Candide had made a trip to America. Our impressions may appear a bit franchouillardes, and perhaps a trifle rude to our American hosts, whose kindness does not deserve such a harsh treatment. © Schweizerische Chemische Gesellschaft. |
Determination of transverse relaxation rates of individual spins while quenching echo modulations due to homonuclear scalar couplings Article de journal N Aeby; G Bodenhausen Chemical Physics Letters, 463 (4-6), p. 418–421, 2008. @article{Aeby:2008, title = {Determination of transverse relaxation rates of individual spins while quenching echo modulations due to homonuclear scalar couplings}, author = {N Aeby and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-52049087616&doi=10.1016%2fj.cplett.2008.08.078&partnerID=40&md5=ef6c883cbfaced95019c0621fc4da552}, doi = {10.1016/j.cplett.2008.08.078}, year = {2008}, date = {2008-01-01}, journal = {Chemical Physics Letters}, volume = {463}, number = {4-6}, pages = {418--421}, abstract = {The envelopes of spin-echo amplitudes obtained with trains of multiple refocusing pulses are normally modulated by homonuclear scalar couplings. Echo modulations make it difficult to determine transverse relaxation rate constants R2. Provided that the pulses are of moderate amplitude so that spins at different offsets experience different tilted effective fields, and provided one avoids recoupling conditions, it is possible to quench the modulations of spin echoes. When the modulations are quenched, apparent transverse relaxation rate constants R2(I) can be determined for individual spins I. The principle is demonstrated for solutions of glycine with single or double carbon-13 enrichment. © 2008 Elsevier B.V. All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The envelopes of spin-echo amplitudes obtained with trains of multiple refocusing pulses are normally modulated by homonuclear scalar couplings. Echo modulations make it difficult to determine transverse relaxation rate constants R2. Provided that the pulses are of moderate amplitude so that spins at different offsets experience different tilted effective fields, and provided one avoids recoupling conditions, it is possible to quench the modulations of spin echoes. When the modulations are quenched, apparent transverse relaxation rate constants R2(I) can be determined for individual spins I. The principle is demonstrated for solutions of glycine with single or double carbon-13 enrichment. © 2008 Elsevier B.V. All rights reserved. |
Evidence for dynamics on a 100 ns time scale from single- and double-quantum nitrogen-14 NMR in solid peptides Article de journal S Cavadini; A Abraham; S Ulzega; G Bodenhausen Journal of the American Chemical Society, 130 (33), p. 10850–10851, 2008. @article{Cavadini:2008a, title = {Evidence for dynamics on a 100 ns time scale from single- and double-quantum nitrogen-14 NMR in solid peptides}, author = {S Cavadini and A Abraham and S Ulzega and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-50249187653&doi=10.1021%2fja802603q&partnerID=40&md5=a2473bf673aaf1b3c5fbea9b6e5ba53f}, doi = {10.1021/ja802603q}, year = {2008}, date = {2008-01-01}, journal = {Journal of the American Chemical Society}, volume = {130}, number = {33}, pages = {10850--10851}, abstract = {The indirect detection of 14N spectra via protons in the manner of heteronuclear multiple-quantum correlation (HMQC) allows one to obtain single- (SQ) and double-quantum (DQ) 14N spectra in solids. A comparison of the SQ and DQ line widths as a function of temperature with simulations reveals motions in the tripeptide AAG with rates on the order of 107 s-1 at 49 °C. Copyright © 2008 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The indirect detection of 14N spectra via protons in the manner of heteronuclear multiple-quantum correlation (HMQC) allows one to obtain single- (SQ) and double-quantum (DQ) 14N spectra in solids. A comparison of the SQ and DQ line widths as a function of temperature with simulations reveals motions in the tripeptide AAG with rates on the order of 107 s-1 at 49 °C. Copyright © 2008 American Chemical Society. |
Efficient heteronuclear decoupling by quenching rotary resonance in solid-state NMR Article de journal M Weingarth; P Tekely; G Bodenhausen Chemical Physics Letters, 466 (4-6), p. 247–251, 2008. @article{Weingarth:2008, title = {Efficient heteronuclear decoupling by quenching rotary resonance in solid-state NMR}, author = {M Weingarth and P Tekely and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-56649107998&doi=10.1016%2fj.cplett.2008.10.041&partnerID=40&md5=297cf4fb359f7d22c6e0b7355b828fd1}, doi = {10.1016/j.cplett.2008.10.041}, year = {2008}, date = {2008-01-01}, journal = {Chemical Physics Letters}, volume = {466}, number = {4-6}, pages = {247--251}, abstract = {We propose a new scheme for heteronuclear decoupling designed for fast magic-angle spinning (MAS), dubbed phase-inverted supercycled sequence for attenuation of rotary resonance (PISSARRO). Its efficiency compares favourably with CW, TPPM, SPINAL and XiX decoupling methods at medium and high RF amplitudes, particularly under conditions where the efficiency of decoupling is affected by undesired rotary resonance effects. © 2008 Elsevier B.V. All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } We propose a new scheme for heteronuclear decoupling designed for fast magic-angle spinning (MAS), dubbed phase-inverted supercycled sequence for attenuation of rotary resonance (PISSARRO). Its efficiency compares favourably with CW, TPPM, SPINAL and XiX decoupling methods at medium and high RF amplitudes, particularly under conditions where the efficiency of decoupling is affected by undesired rotary resonance effects. © 2008 Elsevier B.V. All rights reserved. |
Improving resolution in single-scan 2D spectroscopy Article de journal P Pelupessy; L Duma; G Bodenhausen Journal of Magnetic Resonance, 194 (2), p. 169–174, 2008. @article{Pelupessy:2008, title = {Improving resolution in single-scan 2D spectroscopy}, author = {P Pelupessy and L Duma and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-52949148935&doi=10.1016%2fj.jmr.2008.06.023&partnerID=40&md5=c0d3bd9c575bace07cb3930d09f69adb}, doi = {10.1016/j.jmr.2008.06.023}, year = {2008}, date = {2008-01-01}, journal = {Journal of Magnetic Resonance}, volume = {194}, number = {2}, pages = {169--174}, abstract = {New schemes are introduced that allow one to improve the resolution in the indirect dimension of single-scan 'ultrafast' two-dimensional NMR spectra. The methods combine undersampling with band-selective pulses to recover signals that lie outside the detection bandwidth. The efficiency is illustrated for homonuclear total correlation spectroscopy (TOCSY) of quinidine. © 2008 Elsevier Inc. All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } New schemes are introduced that allow one to improve the resolution in the indirect dimension of single-scan 'ultrafast' two-dimensional NMR spectra. The methods combine undersampling with band-selective pulses to recover signals that lie outside the detection bandwidth. The efficiency is illustrated for homonuclear total correlation spectroscopy (TOCSY) of quinidine. © 2008 Elsevier Inc. All rights reserved. |
Measurement of slow diffusion coefficients of molecules with arbitrary scalar couplings via long-lived spin states Article de journal R Sarkar; P Ahuja; P R Vasos; G Bodenhausen ChemPhysChem, 9 (16), p. 2414–2419, 2008. @article{Sarkar:2008, title = {Measurement of slow diffusion coefficients of molecules with arbitrary scalar couplings via long-lived spin states}, author = {R Sarkar and P Ahuja and P R Vasos and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-55549085884&doi=10.1002%2fcphc.200800476&partnerID=40&md5=5d6b6194032d1cb71569f542896b9a6e}, doi = {10.1002/cphc.200800476}, year = {2008}, date = {2008-01-01}, journal = {ChemPhysChem}, volume = {9}, number = {16}, pages = {2414--2419}, abstract = {New experiments are described for the determination of very slow diffusion constants by nuclear magnetic resonance (NMR) using long-lived (singlet) states. These experiments are suitable for molecules or conformations featuring a wide range of J-couplings. © 2008 Wiley-VCH Verlag GmbH & Co. KGaA.}, keywords = {}, pubstate = {published}, tppubtype = {article} } New experiments are described for the determination of very slow diffusion constants by nuclear magnetic resonance (NMR) using long-lived (singlet) states. These experiments are suitable for molecules or conformations featuring a wide range of J-couplings. © 2008 Wiley-VCH Verlag GmbH & Co. KGaA. |
Predicting NMR relaxation rates in anisotropically tumbling proteins through networks of coupled rotators Article de journal G Nodet; D Abergel; G Bodenhausen ChemPhysChem, 9 (4), p. 625–633, 2008. @article{Nodet:2008, title = {Predicting NMR relaxation rates in anisotropically tumbling proteins through networks of coupled rotators}, author = {G Nodet and D Abergel and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-41149168620&doi=10.1002%2fcphc.200700732&partnerID=40&md5=83bcc0378e6083dd0ae8e51f15bd915b}, doi = {10.1002/cphc.200700732}, year = {2008}, date = {2008-01-01}, journal = {ChemPhysChem}, volume = {9}, number = {4}, pages = {625--633}, abstract = {We show that the prediction of 15N relaxation rates in proteins can be extended to systems with anisotropic global rotational diffusion by using a network of coupled rotators (NCR), starting from a three-dimensional structure. The relaxation rates predicted by this method are confronted in several examples with experiments performed by other groups. The NCR spectral density functions are compared with the results obtained from reduced spectral density mapping. The consequence of the timescales of inter-nal motions on the predicted relaxation rates and the effects of the predicted local anisotropy - present only in the case of anisotropic overall tumbling - on dynamic parameters, are discussed. © 2008 Wiley-VCH Verlag GmbH & Co. KGaA.}, keywords = {}, pubstate = {published}, tppubtype = {article} } We show that the prediction of 15N relaxation rates in proteins can be extended to systems with anisotropic global rotational diffusion by using a network of coupled rotators (NCR), starting from a three-dimensional structure. The relaxation rates predicted by this method are confronted in several examples with experiments performed by other groups. The NCR spectral density functions are compared with the results obtained from reduced spectral density mapping. The consequence of the timescales of inter-nal motions on the predicted relaxation rates and the effects of the predicted local anisotropy - present only in the case of anisotropic overall tumbling - on dynamic parameters, are discussed. © 2008 Wiley-VCH Verlag GmbH & Co. KGaA. |
Revealing molecular self-assembly and geometry of non-covalent halogen bonding by solid-state NMR spectroscopy Article de journal M Weingarth; N Raouafi; B Jouvelet; L Duma; G Bodenhausen; K Boujlel; B Schöllhorn; P Tekely Chemical Communications, (45), p. 5981–5983, 2008. @article{Weingarth:2008a, title = {Revealing molecular self-assembly and geometry of non-covalent halogen bonding by solid-state NMR spectroscopy}, author = {M Weingarth and N Raouafi and B Jouvelet and L Duma and G Bodenhausen and K Boujlel and B Sch\"{o}llhorn and P Tekely}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-56749091652&doi=10.1039%2fb813237b&partnerID=40&md5=23ec83c072c228caeb97b4aa0bb1a5ec}, doi = {10.1039/b813237b}, year = {2008}, date = {2008-01-01}, journal = {Chemical Communications}, number = {45}, pages = {5981--5983}, abstract = {We report a new spectroscopic fingerprint of intermolecular contacts in halogen bond-driven self-assembling aggregates and a precise determination of intermolecular N⋯I distances in microcrystalline samples. © The Royal Society of Chemistry.}, keywords = {}, pubstate = {published}, tppubtype = {article} } We report a new spectroscopic fingerprint of intermolecular contacts in halogen bond-driven self-assembling aggregates and a precise determination of intermolecular N⋯I distances in microcrystalline samples. © The Royal Society of Chemistry. |
Proton chemical shift anisotropy measurements of hydrogen-bonded functional groups by fast magic-angle spinning solid-state NMR spectroscopy Article de journal L Duma; D Abergel; P Tekely; G Bodenhausen Chemical Communications, (20), p. 2361–2363, 2008. @article{Duma:2008a, title = {Proton chemical shift anisotropy measurements of hydrogen-bonded functional groups by fast magic-angle spinning solid-state NMR spectroscopy}, author = {L Duma and D Abergel and P Tekely and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-43749121574&doi=10.1039%2fb801154k&partnerID=40&md5=a14d981e87eda5089b4afcd80ee7cfa0}, doi = {10.1039/b801154k}, year = {2008}, date = {2008-01-01}, journal = {Chemical Communications}, number = {20}, pages = {2361--2363}, abstract = {The suitability of fast MAS solid-state NMR spectroscopy for probing 1H chemical shift anisotropy of hydrogen-bonded species has been demonstrated. © The Royal Society of Chemistry.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The suitability of fast MAS solid-state NMR spectroscopy for probing 1H chemical shift anisotropy of hydrogen-bonded species has been demonstrated. © The Royal Society of Chemistry. |
2007 |
Changing the lens: Biomolecular NMR experiments at very low and very high resolution Article de journal F Ferrage Actualite Chimique, (314), p. 23–29, 2007. @article{Ferrage:2007, title = {Changing the lens: Biomolecular NMR experiments at very low and very high resolution}, author = {F Ferrage}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-37849015253&partnerID=40&md5=d8d229b3abc672995f7ac0359fa19014}, year = {2007}, date = {2007-01-01}, journal = {Actualite Chimique}, number = {314}, pages = {23--29}, abstract = {Nuclear magnetic resonance is a versatile tool to study biological macromolecules. Several methods are commonly used to characterize the structure and dynamics of biomolecules. Two methodological approaches are reviewed in this paper: the first one, at high resolution, makes it possible to access selectively particular information in a macromolecule. This method is based on the development of a new polarization transfer technique. The second method, at low resolution, is designed to measure the translational diffusion coefficient of a macromolecule or a supramolecular object in order to evaluate its size, even in the presence of poorly resolved spectra. After an introduction of useful concepts, the two methods are presented and illustrated by applications to various proteins.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Nuclear magnetic resonance is a versatile tool to study biological macromolecules. Several methods are commonly used to characterize the structure and dynamics of biomolecules. Two methodological approaches are reviewed in this paper: the first one, at high resolution, makes it possible to access selectively particular information in a macromolecule. This method is based on the development of a new polarization transfer technique. The second method, at low resolution, is designed to measure the translational diffusion coefficient of a macromolecule or a supramolecular object in order to evaluate its size, even in the presence of poorly resolved spectra. After an introduction of useful concepts, the two methods are presented and illustrated by applications to various proteins. |
Joint composite-rotation adiabatic-sweep isotope filtration Article de journal E R Valentine; F Ferrage; F Massi; D Cowburn; A G Palmer III Journal of Biomolecular NMR, 38 (1), p. 11–22, 2007. @article{Valentine:2007, title = {Joint composite-rotation adiabatic-sweep isotope filtration}, author = {E R Valentine and F Ferrage and F Massi and D Cowburn and A G Palmer III}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-34248564601&doi=10.1007%2fs10858-006-9131-9&partnerID=40&md5=75b2a27e660afda66ed3207e4e17a110}, doi = {10.1007/s10858-006-9131-9}, year = {2007}, date = {2007-01-01}, journal = {Journal of Biomolecular NMR}, volume = {38}, number = {1}, pages = {11--22}, abstract = {Joint composite-rotation adiabatic-sweep isotope filters are derived by combining the composite-rotation [Stuart AC et al. (1999) J Am Chem Soc 121: 5346-5347] and adiabatic-sweep [Zwahlen C et al. (1997) J Am Chem Soc 119:6711-6721; Kup̂e E, Freeman R (1997) J Magn Reson 127:36-48] approaches. The joint isotope filters have improved broadband filtration performance, even for extreme values of the one-bond 1H-13C scalar coupling constants in proteins and RNA molecules. An average Hamiltonian analysis is used to describe evolution of the heteronuclear scalar coupling interaction during the adiabatic sweeps within the isotope filter sequences. The new isotope filter elements permit improved selective detection of NMR resonance signals originating from 1H spins attached to an unlabeled natural abundance component of a complex in which the other components are labeled with 13C and 15N isotopes. © Springer Science+Business Media B.V. 2007.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Joint composite-rotation adiabatic-sweep isotope filters are derived by combining the composite-rotation [Stuart AC et al. (1999) J Am Chem Soc 121: 5346-5347] and adiabatic-sweep [Zwahlen C et al. (1997) J Am Chem Soc 119:6711-6721; Kup̂e E, Freeman R (1997) J Magn Reson 127:36-48] approaches. The joint isotope filters have improved broadband filtration performance, even for extreme values of the one-bond 1H-13C scalar coupling constants in proteins and RNA molecules. An average Hamiltonian analysis is used to describe evolution of the heteronuclear scalar coupling interaction during the adiabatic sweeps within the isotope filter sequences. The new isotope filter elements permit improved selective detection of NMR resonance signals originating from 1H spins attached to an unlabeled natural abundance component of a complex in which the other components are labeled with 13C and 15N isotopes. © Springer Science+Business Media B.V. 2007. |
Evidence of chemical exchange in recombinant Major Urinary Protein and quenching thereof upon pheromone binding Article de journal C Perazzolo; M Verde; S W Homans; G Bodenhausen Journal of Biomolecular NMR, 38 (1), p. 3–9, 2007. @article{Perazzolo:2007, title = {Evidence of chemical exchange in recombinant Major Urinary Protein and quenching thereof upon pheromone binding}, author = {C Perazzolo and M Verde and S W Homans and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-34248583357&doi=10.1007%2fs10858-006-9110-1&partnerID=40&md5=921758137bc0a5b306b1be6a06061001}, doi = {10.1007/s10858-006-9110-1}, year = {2007}, date = {2007-01-01}, journal = {Journal of Biomolecular NMR}, volume = {38}, number = {1}, pages = {3--9}, abstract = {The internal dynamics of recombinant Major Urinary Protein (rMUP) have been investigated by monitoring transverse nitrogen-15 relaxation using multiple-echo Carr-Purcell-Meiboom-Gill (CPMG) experiments. While the ligand-free protein (APO-rMUP) features extensive evidence of motions on the milliseconds time scale, the complex with 2-methoxy-3-isobutylpyrazine (HOLO-rMUP) appears to be much less mobile on this time scale. At 308 K, exchange rates kex = 500-2000 s-1 were typically observed in APO-rMUP for residues located adjacent to a β-turn comprising residues 83-87. These residues occlude an entry to the binding pocket and have been proposed to be a portal for ligand entry in other members of the lipocalin family, such as the retinol binding protein and the human fatty-acid binding protein. Exchange rates and populations are largely uncorrelated, suggesting local 'breathing' motions rather than a concerted global conformational change. © Springer Science+Business Media B.V. 2007.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The internal dynamics of recombinant Major Urinary Protein (rMUP) have been investigated by monitoring transverse nitrogen-15 relaxation using multiple-echo Carr-Purcell-Meiboom-Gill (CPMG) experiments. While the ligand-free protein (APO-rMUP) features extensive evidence of motions on the milliseconds time scale, the complex with 2-methoxy-3-isobutylpyrazine (HOLO-rMUP) appears to be much less mobile on this time scale. At 308 K, exchange rates kex = 500-2000 s-1 were typically observed in APO-rMUP for residues located adjacent to a β-turn comprising residues 83-87. These residues occlude an entry to the binding pocket and have been proposed to be a portal for ligand entry in other members of the lipocalin family, such as the retinol binding protein and the human fatty-acid binding protein. Exchange rates and populations are largely uncorrelated, suggesting local 'breathing' motions rather than a concerted global conformational change. © Springer Science+Business Media B.V. 2007. |
Extending the scope of singlet-state spectroscopy Article de journal R Sarkar; P Ahuja; D Moskau; P R Vasos; G Bodenhausen ChemPhysChem, 8 (18), p. 2652–2656, 2007. @article{Sarkar:2007, title = {Extending the scope of singlet-state spectroscopy}, author = {R Sarkar and P Ahuja and D Moskau and P R Vasos and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-38049086083&doi=10.1002%2fcphc.200700545&partnerID=40&md5=e8ac4a0543c82f79411fd3047ed01e14}, doi = {10.1002/cphc.200700545}, year = {2007}, date = {2007-01-01}, journal = {ChemPhysChem}, volume = {8}, number = {18}, pages = {2652--2656}, abstract = {Different decoupling sequences are tested - using various shaped radio-frequency (RF) pulses - to achieve the longest possible lifetimes of singlet-state populations over the widest possible bandwidths, that is, ranges of offsets and relative chemical shifts of the nuclei involved in the singlet states. The use of sinc or refocusing broadband universal rotation pulses (RE-BURP) for decoupling during the intervals where singlet-state populations are preserved allows one to extend the useful bandwidth with respect to prior state-of-the-art methods based on composite-pulse WALTZ decoupling. The improved sinc decoupling sequences afford a more reliable and sensitive measure of the lifetimes of singlet states in pairs of spins that have widely different chemical shifts, such as the two aromatic protons H5 and H 6 in uracil. Similar advantages are expected for nucleotides in RNA and DNA. Alternative approaches, in particular frequency-modulated decoupling sequences, also appear to be effective in preserving singlet-state populations, even though the profiles of the apparent relaxation rate constants as a function of the offset are somewhat perturbed. The best decoupling sequences prove their utility in sustaining longer lifetimes of singlet states than previously achieved for the side-chain tyrosine protons in bovine pancreatic trypsin inhibitor (BPTI) at 600 MHz (14.1 T), where the differences of chemical shifts between coupled protons are a challenge. © 2007 Wiley-VCH Verlag GmbH & Co. KGaA.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Different decoupling sequences are tested - using various shaped radio-frequency (RF) pulses - to achieve the longest possible lifetimes of singlet-state populations over the widest possible bandwidths, that is, ranges of offsets and relative chemical shifts of the nuclei involved in the singlet states. The use of sinc or refocusing broadband universal rotation pulses (RE-BURP) for decoupling during the intervals where singlet-state populations are preserved allows one to extend the useful bandwidth with respect to prior state-of-the-art methods based on composite-pulse WALTZ decoupling. The improved sinc decoupling sequences afford a more reliable and sensitive measure of the lifetimes of singlet states in pairs of spins that have widely different chemical shifts, such as the two aromatic protons H5 and H 6 in uracil. Similar advantages are expected for nucleotides in RNA and DNA. Alternative approaches, in particular frequency-modulated decoupling sequences, also appear to be effective in preserving singlet-state populations, even though the profiles of the apparent relaxation rate constants as a function of the offset are somewhat perturbed. The best decoupling sequences prove their utility in sustaining longer lifetimes of singlet states than previously achieved for the side-chain tyrosine protons in bovine pancreatic trypsin inhibitor (BPTI) at 600 MHz (14.1 T), where the differences of chemical shifts between coupled protons are a challenge. © 2007 Wiley-VCH Verlag GmbH & Co. KGaA. |
Indirect detection of nitrogen-14 in solid-state NMR spectroscopy Article de journal S Cavadini; S Antonijevic; A Lupulescu; G Bodenhausen ChemPhysChem, 8 (9), p. 1363–1374, 2007. @article{Cavadini:2007, title = {Indirect detection of nitrogen-14 in solid-state NMR spectroscopy}, author = {S Cavadini and S Antonijevic and A Lupulescu and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-34447519190&doi=10.1002%2fcphc.200700049&partnerID=40&md5=ef825f50d286d515abcff02c7f04f387}, doi = {10.1002/cphc.200700049}, year = {2007}, date = {2007-01-01}, journal = {ChemPhysChem}, volume = {8}, number = {9}, pages = {1363--1374}, abstract = {NMR spectra of 14N (spin I = 1) are obtained by indirect detection in powders spinning at the magic angle. The method relies on the transfer of coherence from a neighboring "spy" nucleus with S = 1/2, such as 13C or 1H, to single- or double-quantum transitions of 14N nuclei. The transfer of coherence can occur through a combination of scalar and residual dipolar splittings (RDS); the latter are also known as second-order quadrupole-dipole cross terms. The two-dimensional NMR spectra reveal powder patterns determined by second- and third-order quadrupolar couplings. These spectra depend on the quadrupolar coupling constant CQ (typically a few megahertz), on the asymmetry parameter ηQ of the 14N nucleus, and on the orientation of the internuclear vector rIS between the I ( 14N) and S (spy) nuclei with respect to the quadrupolar tensor. These parameters, which can be subject to motional averaging, can reveal valuable information about the structure and dynamics of nitrogen-containing solids. Application of this technique to various amino acids, either enriched in 13C or with natural carbon isotope abundance, with spectra recorded at various magnetic fields, illustrates the scope of the method. © 2007 Wiley-VCH Verlag GmbH & Co. KGaA.}, keywords = {}, pubstate = {published}, tppubtype = {article} } NMR spectra of 14N (spin I = 1) are obtained by indirect detection in powders spinning at the magic angle. The method relies on the transfer of coherence from a neighboring "spy" nucleus with S = 1/2, such as 13C or 1H, to single- or double-quantum transitions of 14N nuclei. The transfer of coherence can occur through a combination of scalar and residual dipolar splittings (RDS); the latter are also known as second-order quadrupole-dipole cross terms. The two-dimensional NMR spectra reveal powder patterns determined by second- and third-order quadrupolar couplings. These spectra depend on the quadrupolar coupling constant CQ (typically a few megahertz), on the asymmetry parameter ηQ of the 14N nucleus, and on the orientation of the internuclear vector rIS between the I ( 14N) and S (spy) nuclei with respect to the quadrupolar tensor. These parameters, which can be subject to motional averaging, can reveal valuable information about the structure and dynamics of nitrogen-containing solids. Application of this technique to various amino acids, either enriched in 13C or with natural carbon isotope abundance, with spectra recorded at various magnetic fields, illustrates the scope of the method. © 2007 Wiley-VCH Verlag GmbH & Co. KGaA. |
Measuring fast hydrogen exchange rates by NMR spectroscopy Article de journal F Kateb; P Pelupessy; G Bodenhausen Journal of Magnetic Resonance, 184 (1), p. 108–113, 2007. @article{Kateb:2007, title = {Measuring fast hydrogen exchange rates by NMR spectroscopy}, author = {F Kateb and P Pelupessy and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-33846031611&doi=10.1016%2fj.jmr.2006.09.022&partnerID=40&md5=c8bdef159128871973d471bdbba4936c}, doi = {10.1016/j.jmr.2006.09.022}, year = {2007}, date = {2007-01-01}, journal = {Journal of Magnetic Resonance}, volume = {184}, number = {1}, pages = {108--113}, abstract = {We introduce a method to measure hydrogen exchange rates based on the observation of the coherence of a neighboring spin S such as 15N that has a scalar coupling JIS to the exchanging proton I. The decay of Sx coherence under a Carr-Purcell-Meiboom-Gill (CPMG) multiple echo train is recorded in the presence and absence of proton decoupling. This method allows one to extract proton exchange rates up to 105 s-1. We could extend the pH range for the study of the indole proton in tryptophan, allowing the determination of the exchange constants of the cationic, zwitterionic, and anionic forms of tryptophan. © 2006 Elsevier Inc. All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } We introduce a method to measure hydrogen exchange rates based on the observation of the coherence of a neighboring spin S such as 15N that has a scalar coupling JIS to the exchanging proton I. The decay of Sx coherence under a Carr-Purcell-Meiboom-Gill (CPMG) multiple echo train is recorded in the presence and absence of proton decoupling. This method allows one to extract proton exchange rates up to 105 s-1. We could extend the pH range for the study of the indole proton in tryptophan, allowing the determination of the exchange constants of the cationic, zwitterionic, and anionic forms of tryptophan. © 2006 Elsevier Inc. All rights reserved. |
Networks of coupled rotators: Relationship between structures and internal dynamics in metal-binding proteins. Applications to apo- and holo-calbindin Article de journal A Dhulesia; D Abergel; G Bodenhausen Journal of the American Chemical Society, 129 (16), p. 4998–5006, 2007. @article{Dhulesia:2007, title = {Networks of coupled rotators: Relationship between structures and internal dynamics in metal-binding proteins. Applications to apo- and holo-calbindin}, author = {A Dhulesia and D Abergel and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-34247515255&doi=10.1021%2fja067429w&partnerID=40&md5=3251f3cd503a2a506d34abf755bdcdfe}, doi = {10.1021/ja067429w}, year = {2007}, date = {2007-01-01}, journal = {Journal of the American Chemical Society}, volume = {129}, number = {16}, pages = {4998--5006}, abstract = {This article presents an analysis of the internal dynamics of the Ca 2+-binding protein calbindin, based on the Networks of Coupled Rotators (NCRs) introduced recently. Several fundamental and practical issues raised by this approach are investigated. The roles of various parameters of the model are examined. The NCR model is shown to account for the modifications of the internal dynamics upon Ca2+ binding by calbindin. Two alternative strategies to estimate local internal effective correlation times of the protein are proposed, which offer good agreement between predictions and experiment. © 2007 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } This article presents an analysis of the internal dynamics of the Ca 2+-binding protein calbindin, based on the Networks of Coupled Rotators (NCRs) introduced recently. Several fundamental and practical issues raised by this approach are investigated. The roles of various parameters of the model are examined. The NCR model is shown to account for the modifications of the internal dynamics upon Ca2+ binding by calbindin. Two alternative strategies to estimate local internal effective correlation times of the protein are proposed, which offer good agreement between predictions and experiment. © 2007 American Chemical Society. |
Proton-detected nitrogen-14 NMR by recoupling of heteronuclear dipolar interactions using symmetry-based sequences Article de journal S Cavadini; A Abraham; G Bodenhausen Chemical Physics Letters, 445 (1-3), p. 1–5, 2007. @article{Cavadini:2007a, title = {Proton-detected nitrogen-14 NMR by recoupling of heteronuclear dipolar interactions using symmetry-based sequences}, author = {S Cavadini and A Abraham and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-34548029485&doi=10.1016%2fj.cplett.2007.07.060&partnerID=40&md5=34d9f268400d44dc63bc16c9e0790068}, doi = {10.1016/j.cplett.2007.07.060}, year = {2007}, date = {2007-01-01}, journal = {Chemical Physics Letters}, volume = {445}, number = {1-3}, pages = {1--5}, abstract = {The recoupling of heteronuclear dipolar interactions between 14N and 1H with symmetry-based RN sequences of the R 2059 type applied to protons in samples spinning at the magic angle allows one to excite 14N single-quantum (SQ) or double-quantum (DQ) coherences and reconvert them into observable proton coherences. This offers an alternative to the recoupling of heteronuclear dipolar interactions by rotary resonance. The experimental efficiency of the two-way coherence transfer process is on the order of 9 and 4% for SQ and DQ spectroscopy. Spectra were obtained at 400 and 800 MHz for protons. The parameters of the 14N quadrupolar tensors can be determined in peptides, both in rotating 14 N1 H3+ groups in protonated amines and in rigid 14N1H pairs in amide groups. © 2007 Elsevier B.V. All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The recoupling of heteronuclear dipolar interactions between 14N and 1H with symmetry-based RN sequences of the R 2059 type applied to protons in samples spinning at the magic angle allows one to excite 14N single-quantum (SQ) or double-quantum (DQ) coherences and reconvert them into observable proton coherences. This offers an alternative to the recoupling of heteronuclear dipolar interactions by rotary resonance. The experimental efficiency of the two-way coherence transfer process is on the order of 9 and 4% for SQ and DQ spectroscopy. Spectra were obtained at 400 and 800 MHz for protons. The parameters of the 14N quadrupolar tensors can be determined in peptides, both in rotating 14 N1 H3+ groups in protonated amines and in rigid 14N1H pairs in amide groups. © 2007 Elsevier B.V. All rights reserved. |
Quenching and recoupling of echo modulations in NMR spectroscopy Article de journal K Gopalakrishnan; N Aeby; G Bodenhausen ChemPhysChem, 8 (12), p. 1791–1802, 2007. @article{Gopalakrishnan:2007, title = {Quenching and recoupling of echo modulations in NMR spectroscopy}, author = {K Gopalakrishnan and N Aeby and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-34548434813&doi=10.1002%2fcphc.200700114&partnerID=40&md5=ba57c5b839ff67e9e88d684cac8cbd84}, doi = {10.1002/cphc.200700114}, year = {2007}, date = {2007-01-01}, journal = {ChemPhysChem}, volume = {8}, number = {12}, pages = {1791--1802}, abstract = {Trains of spin echoes are normally modulated by homonuclear scalar couplings. It has long been known that echo modulations are quenched when the pulse-repetition rates are much larger than the offsets of the coupling partners, because the spin systems behave as if they consisted of magnetically equivalent spins when the offsets are suppressed. This type of quenching of the echo modulations can occur when the radio-frequency (RF) pulses are ideal, that is, when they are perfectly homogeneous, properly calibrated to induce rotations through an angle, π, and have an RF amplitude, ω1 = -γB1, that is strong compared to the largest offset, ΩS = ω0S-ωRF, with respect to the carrier frequency. Recently, it was discovered that echo modulations can also be quenched when the RF pulses are nonideal, that is, when they are too weak to bring about an ideal rotation of the magnetization of the coupling partners, so that the effective fields associated with the RF pulses are tilted in the rotating frame. This phenomenon typically occurs when the pulse-repetition rates are much slower than the offset of the coupling partner. Under such conditions, it turns out, however, that for certain offsets, when the phase, ΦS (which arises from a free precession of the magnetization of the coupling partner, S, in the pulse interval. 2τ, and the pulse length, τπ), approaches a multiple of 2π, the echo modulations are restored. However, the frequencies of these echo modulations are not simply determined by the homonuclear scalar coupling, JIS. The Fourier transforms of the echo trains (the so-called "J spectra") reveal surprising multiplet patterns, and the amplitudes of the echo modulations depend on the offsets of the coupling partners. Herein, we present a unified theory, based on an average-Hamiltonian approach, to describe these effects for two-spin systems. Experimental evidence of echo modulations in a system of two spins is presented. Experiments with three and more spins, backed up by extensive numerical simulations, will be presented elsewhere. © 2007 Wiley-VCH Verlag GmbH & Co. KGaA.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Trains of spin echoes are normally modulated by homonuclear scalar couplings. It has long been known that echo modulations are quenched when the pulse-repetition rates are much larger than the offsets of the coupling partners, because the spin systems behave as if they consisted of magnetically equivalent spins when the offsets are suppressed. This type of quenching of the echo modulations can occur when the radio-frequency (RF) pulses are ideal, that is, when they are perfectly homogeneous, properly calibrated to induce rotations through an angle, π, and have an RF amplitude, ω1 = -γB1, that is strong compared to the largest offset, ΩS = ω0S-ωRF, with respect to the carrier frequency. Recently, it was discovered that echo modulations can also be quenched when the RF pulses are nonideal, that is, when they are too weak to bring about an ideal rotation of the magnetization of the coupling partners, so that the effective fields associated with the RF pulses are tilted in the rotating frame. This phenomenon typically occurs when the pulse-repetition rates are much slower than the offset of the coupling partner. Under such conditions, it turns out, however, that for certain offsets, when the phase, ΦS (which arises from a free precession of the magnetization of the coupling partner, S, in the pulse interval. 2τ, and the pulse length, τπ), approaches a multiple of 2π, the echo modulations are restored. However, the frequencies of these echo modulations are not simply determined by the homonuclear scalar coupling, JIS. The Fourier transforms of the echo trains (the so-called "J spectra") reveal surprising multiplet patterns, and the amplitudes of the echo modulations depend on the offsets of the coupling partners. Herein, we present a unified theory, based on an average-Hamiltonian approach, to describe these effects for two-spin systems. Experimental evidence of echo modulations in a system of two spins is presented. Experiments with three and more spins, backed up by extensive numerical simulations, will be presented elsewhere. © 2007 Wiley-VCH Verlag GmbH & Co. KGaA. |
Singlet-state exchange NMR spectroscopy for the study of very slow dynamic processes Article de journal R Sarkar; P R Vasos; G Bodenhausen Journal of the American Chemical Society, 129 (2), p. 328–334, 2007. @article{Sarkar:2007a, title = {Singlet-state exchange NMR spectroscopy for the study of very slow dynamic processes}, author = {R Sarkar and P R Vasos and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-33846245132&doi=10.1021%2fja0647396&partnerID=40&md5=282b1d03de9f542d28246a682ee8503e}, doi = {10.1021/ja0647396}, year = {2007}, date = {2007-01-01}, journal = {Journal of the American Chemical Society}, volume = {129}, number = {2}, pages = {328--334}, abstract = {Singlet states with lifetimes that are longer than spin-lattice relaxation times Ts ≫ T1offer unique opportunities for studying very slow dynamic processes in solution-state NMR. A set of novel experiments can achieve broadband excitation of singlet states in pairs of coupled spins. The most elaborate of these experiments, two-dimensional singlet-state exchange spectroscopy (SS-EXSY), is independent of the offsets of the two spins, their relative chemical shifts, and their scalar couplings. The new methods open the way to study very slow chemical exchange or translational diffusion using mixing times τm ≈ Ts ≫ T1. The lifetimes Ts of singlet states of pairs of protons in a partially deuterated saccharide are shown to be longer than the longitudinal proton relaxation times T1 in the same compound by a factor of ca. 37. © 2007 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Singlet states with lifetimes that are longer than spin-lattice relaxation times Ts ≫ T1offer unique opportunities for studying very slow dynamic processes in solution-state NMR. A set of novel experiments can achieve broadband excitation of singlet states in pairs of coupled spins. The most elaborate of these experiments, two-dimensional singlet-state exchange spectroscopy (SS-EXSY), is independent of the offsets of the two spins, their relative chemical shifts, and their scalar couplings. The new methods open the way to study very slow chemical exchange or translational diffusion using mixing times τm ≈ Ts ≫ T1. The lifetimes Ts of singlet states of pairs of protons in a partially deuterated saccharide are shown to be longer than the longitudinal proton relaxation times T1 in the same compound by a factor of ca. 37. © 2007 American Chemical Society. |
Weak calcium-mediated interactions between Lewis X-related trisaccharides studied by NMR measurements of residual dipolar couplings Article de journal G Nodet; L Poggi; D Abergel; C Gourmala; D Dong; Y Zhang; J -M Mallet; G Bodenhausen Journal of the American Chemical Society, 129 (29), p. 9080–9085, 2007. @article{Nodet:2007a, title = {Weak calcium-mediated interactions between Lewis X-related trisaccharides studied by NMR measurements of residual dipolar couplings}, author = {G Nodet and L Poggi and D Abergel and C Gourmala and D Dong and Y Zhang and J -M Mallet and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-34547539474&doi=10.1021%2fja0711056&partnerID=40&md5=53aca08b440b69755694551b321f0625}, doi = {10.1021/ja0711056}, year = {2007}, date = {2007-01-01}, journal = {Journal of the American Chemical Society}, volume = {129}, number = {29}, pages = {9080--9085}, abstract = {The Lewis X (LeX) determinant, a trisaccharide with the carbohydrate sequence Galβ(1→4)-[Fucα(1→3)]GlcNAcβ, is believed to be responsible for Ca2+-mediated cell-cell interactions. In partly oriented phases composed of mixtures of penta(ethyleneglycol) monododecyl ether HO(CH2CH2O)5C 12H25 and n-hexanol in the presence of Ca2+ ions, the variation of the residual dipolar couplings 1DCH of various CiHi vectors in LeX as a function of the concentration of the trisaccharide demonstrates the existence of very weak LeX-Ca2+-LeX complexes in solution. Synthetic 3-, 4-, and 6-deoxy-LeX variants were also shown to form complexes in the presence of calcium ions, despite the replacement of one of their hydroxyl groups by hydrogen atoms. This is the first direct observation in solution of a calcium-mediated interaction between LeX molecules. © 2007 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The Lewis X (LeX) determinant, a trisaccharide with the carbohydrate sequence Galβ(1→4)-[Fucα(1→3)]GlcNAcβ, is believed to be responsible for Ca2+-mediated cell-cell interactions. In partly oriented phases composed of mixtures of penta(ethyleneglycol) monododecyl ether HO(CH2CH2O)5C 12H25 and n-hexanol in the presence of Ca2+ ions, the variation of the residual dipolar couplings 1DCH of various CiHi vectors in LeX as a function of the concentration of the trisaccharide demonstrates the existence of very weak LeX-Ca2+-LeX complexes in solution. Synthetic 3-, 4-, and 6-deoxy-LeX variants were also shown to form complexes in the presence of calcium ions, despite the replacement of one of their hydroxyl groups by hydrogen atoms. This is the first direct observation in solution of a calcium-mediated interaction between LeX molecules. © 2007 American Chemical Society. |
An overview of recent developments in the interpretation and prediction of fast internal protein dynamics Article de journal G Nodet; D Abergel European Biophysics Journal, 36 (8), p. 985–993, 2007. @article{Nodet:2007, title = {An overview of recent developments in the interpretation and prediction of fast internal protein dynamics}, author = {G Nodet and D Abergel}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-35748939712&doi=10.1007%2fs00249-007-0167-x&partnerID=40&md5=b03987136664528d090ec89ed6e35bc8}, doi = {10.1007/s00249-007-0167-x}, year = {2007}, date = {2007-01-01}, journal = {European Biophysics Journal}, volume = {36}, number = {8}, pages = {985--993}, abstract = {During the past decades, NMR spectroscopy has emerged as a unique tool for the study of protein dynamics. Indeed, relaxation studies on isotopically labeled proteins can provide information on the overall motions as well as the internal fast, sub-nanosecond, dynamics. Therefore, the interpretation and the prediction of spin relaxation rates in proteins are important issues that have motivated numerous theoretical and methodological developments, including the description of overall dynamics and its possible coupling to internal mobility, the introduction of models of internal dynamics, the determination of correlation functions from experimental data, and the relationship between relaxation and thermodynamical quantities. A brief account of recent developments that have proven useful in this domain are presented. © 2007 EBSA.}, keywords = {}, pubstate = {published}, tppubtype = {article} } During the past decades, NMR spectroscopy has emerged as a unique tool for the study of protein dynamics. Indeed, relaxation studies on isotopically labeled proteins can provide information on the overall motions as well as the internal fast, sub-nanosecond, dynamics. Therefore, the interpretation and the prediction of spin relaxation rates in proteins are important issues that have motivated numerous theoretical and methodological developments, including the description of overall dynamics and its possible coupling to internal mobility, the introduction of models of internal dynamics, the determination of correlation functions from experimental data, and the relationship between relaxation and thermodynamical quantities. A brief account of recent developments that have proven useful in this domain are presented. © 2007 EBSA. |
2006 |
F Kateb; D Abergel; Y Blouquit; P Duchambon; C T Craescu; G Bodenhausen Biochemistry, 45 (50), p. 15011–15019, 2006. @article{Kateb:2006, title = {Slow backbone dynamics of the C-terminal fragment of human centrin 2 in complex with a target peptide probed by cross-correlated relaxation in multiple-quantum NMR spectroscopy}, author = {F Kateb and D Abergel and Y Blouquit and P Duchambon and C T Craescu and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-33845575989&doi=10.1021%2fbi061469v&partnerID=40&md5=cb9dd24328030efe21f5a95dba7e6bb1}, doi = {10.1021/bi061469v}, year = {2006}, date = {2006-01-01}, journal = {Biochemistry}, volume = {45}, number = {50}, pages = {15011--15019}, abstract = {The C-terminal domain of human centrin 2 (C-HsCen2) strongly binds to P1-XPC, a peptide comprising 17 amino acids with a NWKLLAKGLLIRERLKR sequence. This peptide corresponds to residues N847-R863 of XPC, a protein involved in the recognition of damaged DNA during the initial step of the nucleotide excision repair pathway. The slow internal dynamics of the protein backbone in the C-HsCen-P1-XPC complex was studied by measuring the relaxation rates of zero- and double-quantum coherences involving neighboring pairs of carbonyl 13C and amide 15N nuclei. These relaxation rates, which reflect dynamics on time scales in the range of micro- to milliseconds, vary significantly along the protein backbone. Analysis of the relaxation rates at different CaCl2 concentrations and ionic strengths shows that these slow motions are mainly affected by the binding of a Ca2+ ion to the lower-affinity EF-hand III. Moreover, we discuss the possible functional role of residues that undergo differential exchange in the formation of HsCen homodimers. © 2006 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The C-terminal domain of human centrin 2 (C-HsCen2) strongly binds to P1-XPC, a peptide comprising 17 amino acids with a NWKLLAKGLLIRERLKR sequence. This peptide corresponds to residues N847-R863 of XPC, a protein involved in the recognition of damaged DNA during the initial step of the nucleotide excision repair pathway. The slow internal dynamics of the protein backbone in the C-HsCen-P1-XPC complex was studied by measuring the relaxation rates of zero- and double-quantum coherences involving neighboring pairs of carbonyl 13C and amide 15N nuclei. These relaxation rates, which reflect dynamics on time scales in the range of micro- to milliseconds, vary significantly along the protein backbone. Analysis of the relaxation rates at different CaCl2 concentrations and ionic strengths shows that these slow motions are mainly affected by the binding of a Ca2+ ion to the lower-affinity EF-hand III. Moreover, we discuss the possible functional role of residues that undergo differential exchange in the formation of HsCen homodimers. © 2006 American Chemical Society. |
Protein backbone dynamics through 13C′-13C α cross-relaxation in NMR spectroscopy Article de journal F Ferrage; P Pelupessy; D Cowburn; G Bodenhausen Journal of the American Chemical Society, 128 (34), p. 11072–11078, 2006. @article{Ferrage:2006, title = {Protein backbone dynamics through 13C′-13C α cross-relaxation in NMR spectroscopy}, author = {F Ferrage and P Pelupessy and D Cowburn and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-33748090298&doi=10.1021%2fja0600577&partnerID=40&md5=3108730b4801207564e4694f629fd277}, doi = {10.1021/ja0600577}, year = {2006}, date = {2006-01-01}, journal = {Journal of the American Chemical Society}, volume = {128}, number = {34}, pages = {11072--11078}, abstract = {Internal dynamics of proteins are usually characterized by the analysis of 15N relaxation rates that reflect the motions of NHN vectors. It was suggested a decade ago that additional information on backbone motions can be obtained by measuring cross-relaxation rates associated with intra-residue C′Cα vectors. Here we propose a new approach to such measurements, based on the observation of the transfer between two-spin orders 2NzC′z and 2NzC z α. This amounts to "anchoring" the C′z and Cz α operators to the N z term from the amide of the next residue. In combination with symmetrical reconversion, this method greatly reduces various artifacts. The experiment is carried out on human ubiquitin at 284.1 K, where the correlation time is 7.1 ns. The motions of the C′Cα vector appear more restricted than those of the NHN vector. © 2006 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Internal dynamics of proteins are usually characterized by the analysis of 15N relaxation rates that reflect the motions of NHN vectors. It was suggested a decade ago that additional information on backbone motions can be obtained by measuring cross-relaxation rates associated with intra-residue C′Cα vectors. Here we propose a new approach to such measurements, based on the observation of the transfer between two-spin orders 2NzC′z and 2NzC z α. This amounts to "anchoring" the C′z and Cz α operators to the N z term from the amide of the next residue. In combination with symmetrical reconversion, this method greatly reduces various artifacts. The experiment is carried out on human ubiquitin at 284.1 K, where the correlation time is 7.1 ns. The motions of the C′Cα vector appear more restricted than those of the NHN vector. © 2006 American Chemical Society. |
Determination of dihedral Ψ angles in large proteins by combining NHN/CαHα dipole/dipole cross-correlation and chemical shifts Article de journal K Loth; D Abergel; P Pelupessy; M Delarue; P Lopes; J Ouazzani; N Duclert-Savatier; M Nilges; G Bodenhausen; V Stoven Proteins: Structure, Function and Genetics, 64 (4), p. 931–939, 2006. @article{Loth:2006, title = {Determination of dihedral Ψ angles in large proteins by combining NHN/CαHα dipole/dipole cross-correlation and chemical shifts}, author = {K Loth and D Abergel and P Pelupessy and M Delarue and P Lopes and J Ouazzani and N Duclert-Savatier and M Nilges and G Bodenhausen and V Stoven}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-33748455090&doi=10.1002%2fprot.21063&partnerID=40&md5=c6a8c64f4558525854e7c49aecaa379c}, doi = {10.1002/prot.21063}, year = {2006}, date = {2006-01-01}, journal = {Proteins: Structure, Function and Genetics}, volume = {64}, number = {4}, pages = {931--939}, abstract = {We propose a strategy based on the combination of experimental NH N/CαHα dipole/dipole cross-correlated relaxation rates and chemical shift analysis for the determination of Ψ torsion angles in proteins. The method allows the determination of a dihedral angle that is not easily accessible by nuclear magnetic resonance (NMR). The measurement of dihedral angle restraints can be used for structure calculation, which is known to improve the quality of NMR structures. The method is of particular interest in the case of large proteins, for which spectral assignment of the nuclear Overhauser effect spectra, and therefore straightforward structural determination, is out of reach. One advantage of the method is that it is reasonably simple to implement, and could be used in association with other methods aiming at obtaining structural information on complex systems, such as residual dipolar coupling measurements. An illustrative example is analyzed in the case of the 30-kDa protein 6-phosphogluconolactonase. © 2006 Wiley-Liss, Inc.}, keywords = {}, pubstate = {published}, tppubtype = {article} } We propose a strategy based on the combination of experimental NH N/CαHα dipole/dipole cross-correlated relaxation rates and chemical shift analysis for the determination of Ψ torsion angles in proteins. The method allows the determination of a dihedral angle that is not easily accessible by nuclear magnetic resonance (NMR). The measurement of dihedral angle restraints can be used for structure calculation, which is known to improve the quality of NMR structures. The method is of particular interest in the case of large proteins, for which spectral assignment of the nuclear Overhauser effect spectra, and therefore straightforward structural determination, is out of reach. One advantage of the method is that it is reasonably simple to implement, and could be used in association with other methods aiming at obtaining structural information on complex systems, such as residual dipolar coupling measurements. An illustrative example is analyzed in the case of the 30-kDa protein 6-phosphogluconolactonase. © 2006 Wiley-Liss, Inc. |
Kinetics of RNA refolding in dynamic equilibrium by1H-detected 15N exchange NMR spectroscopy Article de journal P Wenter; G Bodenhausen; J Dittmer; S Pitsch Journal of the American Chemical Society, 128 (23), p. 7579–7587, 2006. @article{Wenter:2006, title = {Kinetics of RNA refolding in dynamic equilibrium by1H-detected 15N exchange NMR spectroscopy}, author = {P Wenter and G Bodenhausen and J Dittmer and S Pitsch}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-33745015517&doi=10.1021%2fja060344a&partnerID=40&md5=a4b0c30211b9e54f84f6a807925c4d96}, doi = {10.1021/ja060344a}, year = {2006}, date = {2006-01-01}, journal = {Journal of the American Chemical Society}, volume = {128}, number = {23}, pages = {7579--7587}, abstract = {By implementing new NMR methods that were designed to map very slow exchange processes we have investigated and characterized the refolding kinetics of a thermodynamically stable 34mer RNA sequence in dynamic equilibrium. The RNA sequence was designed to undergo a topologically favored conformational exchange between different hairpin folds, serving as a model to estimate the minimal time required for more complex RNA folding processes. Chemically prepared RNA sequences with sequence-selective 15N labels provided the required signal separation and allowed a straightforward signal assignment of the imino protons by HNN correlation experiments. The 2D version of the new 1H-detected 15N exchange spectroscopy (EXSY) pulse sequence provided cross-peaks for resonances belonging to different folds that interchange on the time scale of longitudinal relaxation of 15N nuclei bound to imino protons. The 34mer RNA sequence exhibits two folds which exchange on the observable time scale (τobs ≈ T 115N < 5 s) and a third fold which is static on this time scale. A 1D version of the 15N exchange experiment allowed the measurement of the exchange rates between the two exchanging folds as a function of temperature and the determination of the corresponding activation energies Ea and frequency factors A. We found that the refolding rates are strongly affected by an entropically favorable preorientation of the replacing strand. The activation energies are comparable to values obtained for the slow refolding of RNA sequences of similar thermodynamic stability but less favorable topology. © 2006 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } By implementing new NMR methods that were designed to map very slow exchange processes we have investigated and characterized the refolding kinetics of a thermodynamically stable 34mer RNA sequence in dynamic equilibrium. The RNA sequence was designed to undergo a topologically favored conformational exchange between different hairpin folds, serving as a model to estimate the minimal time required for more complex RNA folding processes. Chemically prepared RNA sequences with sequence-selective 15N labels provided the required signal separation and allowed a straightforward signal assignment of the imino protons by HNN correlation experiments. The 2D version of the new 1H-detected 15N exchange spectroscopy (EXSY) pulse sequence provided cross-peaks for resonances belonging to different folds that interchange on the time scale of longitudinal relaxation of 15N nuclei bound to imino protons. The 34mer RNA sequence exhibits two folds which exchange on the observable time scale (τobs ≈ T 115N < 5 s) and a third fold which is static on this time scale. A 1D version of the 15N exchange experiment allowed the measurement of the exchange rates between the two exchanging folds as a function of temperature and the determination of the corresponding activation energies Ea and frequency factors A. We found that the refolding rates are strongly affected by an entropically favorable preorientation of the replacing strand. The activation energies are comparable to values obtained for the slow refolding of RNA sequences of similar thermodynamic stability but less favorable topology. © 2006 American Chemical Society. |
Indirect detection of nitrogen-14 in solids via protons by nuclear magnetic resonance spectroscopy Article de journal S Cavadini; S Antonijevic; A Lupulescu; G Bodenhausen Journal of Magnetic Resonance, 182 (1), p. 168–172, 2006. @article{Cavadini:2006, title = {Indirect detection of nitrogen-14 in solids via protons by nuclear magnetic resonance spectroscopy}, author = {S Cavadini and S Antonijevic and A Lupulescu and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-33747871346&doi=10.1016%2fj.jmr.2006.06.003&partnerID=40&md5=b1983076add110fc2dd66227d5e47075}, doi = {10.1016/j.jmr.2006.06.003}, year = {2006}, date = {2006-01-01}, journal = {Journal of Magnetic Resonance}, volume = {182}, number = {1}, pages = {168--172}, abstract = {This Communication describes the indirect detection of 14N nuclei (spin I = 1) in solids by nuclear magnetic resonance (NMR) spectroscopy. The two-dimensional correlation method used here is closely related to the heteronuclear multiple quantum correlation (HMQC) experiment introduced in 1979 to study molecules in liquids, which has recently been used to study solids spinning at the magic angle. The difference is that the coherence transfer from neighboring 1H nuclei to 14N is achieved via a combination of J couplings and residual dipolar splittings (RDS). Projections of the two-dimensional correlation spectra onto the 14N dimension yield powder patterns which reflect the 14N quadrupolar interaction. In contrast to the indirect detection of 14N via 13C nuclei that was recently demonstrated [Gan, J. Am. Chem. Soc. 128 (2006) 6040; Cavadini et. al., J. Am. Chem. Soc., 128 (2006) 7706], this approach may benefit from enhanced sensitivity, and does not require isotopic enrichment in 13C, although the 1H line-widths may have to be reduced upon selective deuteration. © 2006 Elsevier Inc. All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } This Communication describes the indirect detection of 14N nuclei (spin I = 1) in solids by nuclear magnetic resonance (NMR) spectroscopy. The two-dimensional correlation method used here is closely related to the heteronuclear multiple quantum correlation (HMQC) experiment introduced in 1979 to study molecules in liquids, which has recently been used to study solids spinning at the magic angle. The difference is that the coherence transfer from neighboring 1H nuclei to 14N is achieved via a combination of J couplings and residual dipolar splittings (RDS). Projections of the two-dimensional correlation spectra onto the 14N dimension yield powder patterns which reflect the 14N quadrupolar interaction. In contrast to the indirect detection of 14N via 13C nuclei that was recently demonstrated [Gan, J. Am. Chem. Soc. 128 (2006) 6040; Cavadini et. al., J. Am. Chem. Soc., 128 (2006) 7706], this approach may benefit from enhanced sensitivity, and does not require isotopic enrichment in 13C, although the 1H line-widths may have to be reduced upon selective deuteration. © 2006 Elsevier Inc. All rights reserved. |
Lifetimes of the singlet-states under coherent off-resonance irradiation in NMR spectroscopy Article de journal K Gopalakrishnan; G Bodenhausen Journal of Magnetic Resonance, 182 (2), p. 254–259, 2006. @article{Gopalakrishnan:2006, title = {Lifetimes of the singlet-states under coherent off-resonance irradiation in NMR spectroscopy}, author = {K Gopalakrishnan and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-33749058965&doi=10.1016%2fj.jmr.2006.07.001&partnerID=40&md5=8faad4717bdb627352a7ebd42d8b5ce5}, doi = {10.1016/j.jmr.2006.07.001}, year = {2006}, date = {2006-01-01}, journal = {Journal of Magnetic Resonance}, volume = {182}, number = {2}, pages = {254--259}, abstract = {Singlet-states textbar S 〉 = (textbar α β 〉 - textbar β α 〉) / sqrt(2) can be excited in pairs of coupled spins I and S, first by preparing either a non-vanishing zero-quantum coherence I+S- or a state of longitudinal two-spin order IzSz and then by applying a coherent radio-frequency (RF) irradiation with a carrier frequency ωrf = (ΩI + ΩS)/2 that lies half-way between the chemical shifts of the two spins involved. The life-times TS can be much longer than the spin-lattice relaxation time T1 of longitudinal magnetization, but singlet-states are ultimately relaxed, not only by dipolar interactions between the active spins or with the external spins, but also as a result of a non-vanishing offset Δω = ωrf - (ΩI + ΩS)/2 or an insufficient amplitude of the RF irradiation that fails to fulfill the condition ω1 ≫ ΔΩ = (ΩI - ΩS). In this work, the effect of off-resonance irradiation is explored and an approximate formula for the effective relaxation rate of the singlet population is provided on the basis of perturbation theory. The qualitative features of the dependence of the relaxation rate of the singlet population on the offset Δω and on the difference ΔΩ of the chemical shifts of the two spins are illustrated by comparison with numerical simulations. © 2006 Elsevier Inc. All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Singlet-states textbar S 〉 = (textbar α β 〉 - textbar β α 〉) / sqrt(2) can be excited in pairs of coupled spins I and S, first by preparing either a non-vanishing zero-quantum coherence I+S- or a state of longitudinal two-spin order IzSz and then by applying a coherent radio-frequency (RF) irradiation with a carrier frequency ωrf = (ΩI + ΩS)/2 that lies half-way between the chemical shifts of the two spins involved. The life-times TS can be much longer than the spin-lattice relaxation time T1 of longitudinal magnetization, but singlet-states are ultimately relaxed, not only by dipolar interactions between the active spins or with the external spins, but also as a result of a non-vanishing offset Δω = ωrf - (ΩI + ΩS)/2 or an insufficient amplitude of the RF irradiation that fails to fulfill the condition ω1 ≫ ΔΩ = (ΩI - ΩS). In this work, the effect of off-resonance irradiation is explored and an approximate formula for the effective relaxation rate of the singlet population is provided on the basis of perturbation theory. The qualitative features of the dependence of the relaxation rate of the singlet population on the offset Δω and on the difference ΔΩ of the chemical shifts of the two spins are illustrated by comparison with numerical simulations. © 2006 Elsevier Inc. All rights reserved. |
Nitrogen-14 NMR spectroscopy using residual dipolar splittings in solids Article de journal S Cavadini; A Lupulescu; S Antonijevic; G Bodenhausen Journal of the American Chemical Society, 128 (24), p. 7706–7707, 2006. @article{Cavadini:2006a, title = {Nitrogen-14 NMR spectroscopy using residual dipolar splittings in solids}, author = {S Cavadini and A Lupulescu and S Antonijevic and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-33745396554&doi=10.1021%2fja0618898&partnerID=40&md5=013ce17cfaf1e4d69e0d1f27464fb308}, doi = {10.1021/ja0618898}, year = {2006}, date = {2006-01-01}, journal = {Journal of the American Chemical Society}, volume = {128}, number = {24}, pages = {7706--7707}, abstract = {It is shown that nuclear magnetic resonance (NMR) spectra of nitrogen-14 (spin I = 1) can be obtained by indirect detection in powders spinning at the magic angle (MAS). The method relies on the transfer of coherence from a neighboring nucleus with S = 1/2, such as carbon-13, to single- or double-quantum transitions of nitrogen-14 nuclei. The transfer of coherence occurs through second-order quadrupole-dipole cross terms, also known as residual dipolar splittings. The two-dimensional NMR spectra reveal powder patterns determined by the second-order quadrupolar interactions of nitrogen-14. Analysis of the spectra yields the quadrupolar coupling constant, CQ, and asymmetry parameter, ηQ, of nitrogen-14. These parameters can be related to the structure of nitrogen-containing solids. Copyright © 2006 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } It is shown that nuclear magnetic resonance (NMR) spectra of nitrogen-14 (spin I = 1) can be obtained by indirect detection in powders spinning at the magic angle (MAS). The method relies on the transfer of coherence from a neighboring nucleus with S = 1/2, such as carbon-13, to single- or double-quantum transitions of nitrogen-14 nuclei. The transfer of coherence occurs through second-order quadrupole-dipole cross terms, also known as residual dipolar splittings. The two-dimensional NMR spectra reveal powder patterns determined by the second-order quadrupolar interactions of nitrogen-14. Analysis of the spectra yields the quadrupolar coupling constant, CQ, and asymmetry parameter, ηQ, of nitrogen-14. These parameters can be related to the structure of nitrogen-containing solids. Copyright © 2006 American Chemical Society. |
Quenching echo modulations in NMR spectroscopy Article de journal J Dittmer; G Bodenhausen ChemPhysChem, 7 (4), p. 831–836, 2006. @article{Dittmer:2006, title = {Quenching echo modulations in NMR spectroscopy}, author = {J Dittmer and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-33645821669&doi=10.1002%2fcphc.200500403&partnerID=40&md5=8e09db19bc23dd35c590fa9601fe19e6}, doi = {10.1002/cphc.200500403}, year = {2006}, date = {2006-01-01}, journal = {ChemPhysChem}, volume = {7}, number = {4}, pages = {831--836}, abstract = {In NMR spectroscopy, homonuclear scalar couplings normally lead to modulations of spin echoes that tend to interfere with the accurate determination of transverse relaxation rates by Carr-Purcell-Meiboom-Gill (CPMG) multiple refocusing experiments. Surprisingly, the echo modulations are largely cancelled when the refocusing pulses applied to the coupling partner deviate slightly from ideal π rotations due to tilted effective radio-frequency (RF) fields, even at offsets that are much smaller than the radio-frequency amplitude. Experiments and simulations illustrate these effects for two-spin IS systems containing donor and acceptor 15N nuclei I=ND and S=NA in RNA Watson-Crick base pairs with homonuclear scalar couplings JIS=2hJ(ND,NA) across the hydrogen bonds. © 2006 Wiley-VCH Verlag GmbH & Co. KGaA.}, keywords = {}, pubstate = {published}, tppubtype = {article} } In NMR spectroscopy, homonuclear scalar couplings normally lead to modulations of spin echoes that tend to interfere with the accurate determination of transverse relaxation rates by Carr-Purcell-Meiboom-Gill (CPMG) multiple refocusing experiments. Surprisingly, the echo modulations are largely cancelled when the refocusing pulses applied to the coupling partner deviate slightly from ideal π rotations due to tilted effective radio-frequency (RF) fields, even at offsets that are much smaller than the radio-frequency amplitude. Experiments and simulations illustrate these effects for two-spin IS systems containing donor and acceptor 15N nuclei I=ND and S=NA in RNA Watson-Crick base pairs with homonuclear scalar couplings JIS=2hJ(ND,NA) across the hydrogen bonds. © 2006 Wiley-VCH Verlag GmbH & Co. KGaA. |
Quadrupolar transfer pathways Article de journal S Antonijevic; G Bodenhausen Journal of Magnetic Resonance, 180 (2), p. 297–304, 2006. @article{Antonijevic:2006, title = {Quadrupolar transfer pathways}, author = {S Antonijevic and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-33646365598&doi=10.1016%2fj.jmr.2006.02.003&partnerID=40&md5=fdab1dc2db44316df0a50ba4418a4a9f}, doi = {10.1016/j.jmr.2006.02.003}, year = {2006}, date = {2006-01-01}, journal = {Journal of Magnetic Resonance}, volume = {180}, number = {2}, pages = {297--304}, abstract = {A set of graphical conventions called quadrupolar transfer pathways is proposed to describe a wide range of experiments designed for the study of quadrupolar nuclei with spin quantum numbers I = 1, 3/2, 2, 5/2, etc. These pathways, which inter alea allow one to appreciate the distinction between quadrupolar and Zeeman echoes, represent a generalization of the well-known coherence transfer pathways. Quadrupolar transfer pathways not merely distinguish coherences with different orders -2I less-than or slanted equal to p less-than or slanted equal to +2I, but allow one to follow the fate of coherences associated with single transitions that have the same coherence order p = mIr - mIs but can be distinguished by a satellite order q = ( mIr )2 - ( mIs )2 . © 2006 Elsevier Inc. All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } A set of graphical conventions called quadrupolar transfer pathways is proposed to describe a wide range of experiments designed for the study of quadrupolar nuclei with spin quantum numbers I = 1, 3/2, 2, 5/2, etc. These pathways, which inter alea allow one to appreciate the distinction between quadrupolar and Zeeman echoes, represent a generalization of the well-known coherence transfer pathways. Quadrupolar transfer pathways not merely distinguish coherences with different orders -2I less-than or slanted equal to p less-than or slanted equal to +2I, but allow one to follow the fate of coherences associated with single transitions that have the same coherence order p = mIr - mIs but can be distinguished by a satellite order q = ( mIr )2 - ( mIs )2 . © 2006 Elsevier Inc. All rights reserved. |
2005 |
An approach to extract rate constants from reaction-diffusion dynamics in a microchannel Article de journal J -B Salmon; C Dubrocq; P Tabeling; S Charier; D Alcor; L Jullien; F Ferrage Analytical Chemistry, 77 (11), p. 3417–3424, 2005. @article{Salmon:2005, title = {An approach to extract rate constants from reaction-diffusion dynamics in a microchannel}, author = {J -B Salmon and C Dubrocq and P Tabeling and S Charier and D Alcor and L Jullien and F Ferrage}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-20444391378&doi=10.1021%2fac0500838&partnerID=40&md5=069b35f666f1edab8f021528a9616794}, doi = {10.1021/ac0500838}, year = {2005}, date = {2005-01-01}, journal = {Analytical Chemistry}, volume = {77}, number = {11}, pages = {3417--3424}, abstract = {A theoretical model is proposed to extract rate constants of second-order chemical reactions down to the millisecond time scale from the observation of reaction-diffusion processes in a microchannel. We validate this theoretical approach by examining an appropriate model reaction. The measured rate constant is in excellent agreement with this obtained from nuclear magnetic resonance experiments. © 2005 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } A theoretical model is proposed to extract rate constants of second-order chemical reactions down to the millisecond time scale from the observation of reaction-diffusion processes in a microchannel. We validate this theoretical approach by examining an appropriate model reaction. The measured rate constant is in excellent agreement with this obtained from nuclear magnetic resonance experiments. © 2005 American Chemical Society. |
Stochastic resonance to control diffusive motion in chemistry Article de journal D Alcor; J -F Allemand; E Cogné-Laage; V Croquette; F Ferrage; L Jullien; A Kononov; A Lemarchand Journal of Physical Chemistry B, 109 (3), p. 1318–1328, 2005. @article{Alcor:2005, title = {Stochastic resonance to control diffusive motion in chemistry}, author = {D Alcor and J -F Allemand and E Cogn\'{e}-Laage and V Croquette and F Ferrage and L Jullien and A Kononov and A Lemarchand}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-13444261095&doi=10.1021%2fjp0468307&partnerID=40&md5=16630c2883d35adddf4ee32f3b8185c1}, doi = {10.1021/jp0468307}, year = {2005}, date = {2005-01-01}, journal = {Journal of Physical Chemistry B}, volume = {109}, number = {3}, pages = {1318--1328}, abstract = {This paper reports on a novel procedure to tune the effective diffusion coefficient of a field-sensitive reactant in the presence of a periodic external field. We investigate the motion of two negatively charged azo dyes interacting with α-cyclodextrin (α-CD) upon action of a periodic square wave electrical field. We show that the dyes exhibit an effective diffusion coefficient Deff that depends on the rate constants for dye complexation within α-CD, the period and the amplitude of the field. UV-vis absorption, gradient field 1H NMR, and fluorescence correlation spectroscopy (FCS) after two photon excitation are used to evidence that Deff may be increased far beyond its intrinsic value when specific relations interpreted as a stochastic resonance are fulfilled. The present results may find useful applications in chemical kinetics as well as for molecular sorting.}, keywords = {}, pubstate = {published}, tppubtype = {article} } This paper reports on a novel procedure to tune the effective diffusion coefficient of a field-sensitive reactant in the presence of a periodic external field. We investigate the motion of two negatively charged azo dyes interacting with α-cyclodextrin (α-CD) upon action of a periodic square wave electrical field. We show that the dyes exhibit an effective diffusion coefficient Deff that depends on the rate constants for dye complexation within α-CD, the period and the amplitude of the field. UV-vis absorption, gradient field 1H NMR, and fluorescence correlation spectroscopy (FCS) after two photon excitation are used to evidence that Deff may be increased far beyond its intrinsic value when specific relations interpreted as a stochastic resonance are fulfilled. The present results may find useful applications in chemical kinetics as well as for molecular sorting. |
Anisotropic local motions and location of amide protons in proteins Article de journal D Bytchenkoff; P Pelupessy; G Bodenhausen Journal of the American Chemical Society, 127 (14), p. 5180–5185, 2005. @article{Bytchenkoff:2005, title = {Anisotropic local motions and location of amide protons in proteins}, author = {D Bytchenkoff and P Pelupessy and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-17144431390&doi=10.1021%2fja043575v&partnerID=40&md5=9c69b4a318f0c288df26a07cb78e6dc1}, doi = {10.1021/ja043575v}, year = {2005}, date = {2005-01-01}, journal = {Journal of the American Chemical Society}, volume = {127}, number = {14}, pages = {5180--5185}, abstract = {A new method has been developed to obtain dynamic and structural information about peptide planes in proteins by a combination of measurements of weak short-range cross-correlation rates R(HNN/ NC') that are due to concerted fluctuations of the HN-N and N-C' dipole-dipole interactions and stronger long-range cross-correlation rates R(\'{C}H N/HNN) and R(NHN/HNC α). The rates were interpreted using the axially symmetric Gaussian axial fluctuation model (GAF). The oscillation amplitudes as well as the positions of HN atoms with respect to peptide planes in ubiquitin were determined. Most N-HN bonds were found not to lie exactly along the bisector of the N-C' and N-Cα bonds but to be slightly tilted toward the carbon-terminal side of the peptide. © 2005 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } A new method has been developed to obtain dynamic and structural information about peptide planes in proteins by a combination of measurements of weak short-range cross-correlation rates R(HNN/ NC') that are due to concerted fluctuations of the HN-N and N-C' dipole-dipole interactions and stronger long-range cross-correlation rates R(ĆH N/HNN) and R(NHN/HNC α). The rates were interpreted using the axially symmetric Gaussian axial fluctuation model (GAF). The oscillation amplitudes as well as the positions of HN atoms with respect to peptide planes in ubiquitin were determined. Most N-HN bonds were found not to lie exactly along the bisector of the N-C' and N-Cα bonds but to be slightly tilted toward the carbon-terminal side of the peptide. © 2005 American Chemical Society. |
Chemical shift anisotropy tensors of carbonyl, nitrogen, and amide proton nuclei in proteins through cross-correlated relaxation in NMR spectroscopy Article de journal K Loth; P Pelupessy; G Bodenhausen Journal of the American Chemical Society, 127 (16), p. 6062–6068, 2005. @article{Loth:2005, title = {Chemical shift anisotropy tensors of carbonyl, nitrogen, and amide proton nuclei in proteins through cross-correlated relaxation in NMR spectroscopy}, author = {K Loth and P Pelupessy and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-17744366182&doi=10.1021%2fja042863o&partnerID=40&md5=d14d549e6d023496553b5964626ac731}, doi = {10.1021/ja042863o}, year = {2005}, date = {2005-01-01}, journal = {Journal of the American Chemical Society}, volume = {127}, number = {16}, pages = {6062--6068}, abstract = {The principal components and orientations of the chemical shift anisotropy (CSA) tensors of the carbonyl (C′), nitrogen (N), and amide proton (H N) nuclei of 64 distinct amide bonds in human ubiquitin have been determined in isotropic solution by a set of 14 complementary auto- and cross-correlated relaxation rates involving the CSA interactions of the nuclei of interest and several dipole-dipole (DD) interactions. The CSA parameters thus obtained depend to some degree on the models used for local motions. Three cases have been considered: restricted isotropic diffusion, three-dimensional Gaussian axial fluctuations (3D-GAF), and independent out-of-plane motions of the NHN vectors with respect to the peptide planes. © 2005 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The principal components and orientations of the chemical shift anisotropy (CSA) tensors of the carbonyl (C′), nitrogen (N), and amide proton (H N) nuclei of 64 distinct amide bonds in human ubiquitin have been determined in isotropic solution by a set of 14 complementary auto- and cross-correlated relaxation rates involving the CSA interactions of the nuclei of interest and several dipole-dipole (DD) interactions. The CSA parameters thus obtained depend to some degree on the models used for local motions. Three cases have been considered: restricted isotropic diffusion, three-dimensional Gaussian axial fluctuations (3D-GAF), and independent out-of-plane motions of the NHN vectors with respect to the peptide planes. © 2005 American Chemical Society. |
Effects of protein-pheromone complexation on correlated chemical shift modulations Article de journal C Perazzolo; J Wist; K Loth; L Poggi; S Homans; G Bodenhausen Journal of Biomolecular NMR, 33 (4), p. 233–242, 2005. @article{Perazzolo:2005, title = {Effects of protein-pheromone complexation on correlated chemical shift modulations}, author = {C Perazzolo and J Wist and K Loth and L Poggi and S Homans and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-31044439149&doi=10.1007%2fs10858-005-3355-y&partnerID=40&md5=93c2d01747a2f563745bc8dc9f81e3f0}, doi = {10.1007/s10858-005-3355-y}, year = {2005}, date = {2005-01-01}, journal = {Journal of Biomolecular NMR}, volume = {33}, number = {4}, pages = {233--242}, abstract = {Major urinary protein (MUP) is a pheromone-carrying protein of the lipocalin family. Previous studies by isothermal titration calorimetry (ITC) show that the affinity of MUP for the pheromone 2-methoxy-3-isobutylpyrazine (IBMP) is mainly driven by enthalpy, with a small unfavourable entropic contribution. Entropic terms can be attributed in part to changes in internal motions of the protein upon binding. Slow internal motions can lead to correlated or anti-correlated modulations of the isotropic chemical shifts of carbonyl C′ and amide N nuclei. Correlated chemical shift modulations (CSM/CSM) in MUP have been determined by measuring differences of the transverse relaxation rates of zero- and double-quantum coherences ZQCC′N and DQCC′N, and by accounting for the effects of correlated fluctuations of dipole-dipole couplings (DD/DD) and chemical shift anisotropies (CSA/CSA). The latter can be predicted from tensor parameters of C′ and N nuclei that have been determined in earlier work. The effects of complexation on slow time-scale protein dynamics can be determined by comparing the temperature dependence of the relaxation rates of APO-MUP (i.e., without ligand) and HOLO-MUP (i.e., with IBMP as a ligand). © Springer 2005.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Major urinary protein (MUP) is a pheromone-carrying protein of the lipocalin family. Previous studies by isothermal titration calorimetry (ITC) show that the affinity of MUP for the pheromone 2-methoxy-3-isobutylpyrazine (IBMP) is mainly driven by enthalpy, with a small unfavourable entropic contribution. Entropic terms can be attributed in part to changes in internal motions of the protein upon binding. Slow internal motions can lead to correlated or anti-correlated modulations of the isotropic chemical shifts of carbonyl C′ and amide N nuclei. Correlated chemical shift modulations (CSM/CSM) in MUP have been determined by measuring differences of the transverse relaxation rates of zero- and double-quantum coherences ZQCC′N and DQCC′N, and by accounting for the effects of correlated fluctuations of dipole-dipole couplings (DD/DD) and chemical shift anisotropies (CSA/CSA). The latter can be predicted from tensor parameters of C′ and N nuclei that have been determined in earlier work. The effects of complexation on slow time-scale protein dynamics can be determined by comparing the temperature dependence of the relaxation rates of APO-MUP (i.e., without ligand) and HOLO-MUP (i.e., with IBMP as a ligand). © Springer 2005. |
Determination of 13C CSA tensors: Extension of the model-independent approach to an RNA kissing complex undergoing anisotropic rotational diffusion in solution Article de journal S Ravindranathan; C -H Kim; G Bodenhausen Journal of Biomolecular NMR, 33 (3), p. 163–174, 2005. @article{Ravindranathan:2005, title = {Determination of 13C CSA tensors: Extension of the model-independent approach to an RNA kissing complex undergoing anisotropic rotational diffusion in solution}, author = {S Ravindranathan and C -H Kim and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-31444446857&doi=10.1007%2fs10858-005-3472-7&partnerID=40&md5=82d8041479300327c707afa53864e1b8}, doi = {10.1007/s10858-005-3472-7}, year = {2005}, date = {2005-01-01}, journal = {Journal of Biomolecular NMR}, volume = {33}, number = {3}, pages = {163--174}, abstract = {Chemical shift anisotropy (CSA) tensor parameters have been determined for the protonated carbons of the purine bases in an RNA kissing complex in solution by extending the model-independent approach [Fushman, D., Cowburn, D. (1998) J. Am. Chem. Soc. 120, 7109-7110]. A strategy for determining CSA tensor parameters of heteronuclei in isolated X-H two-spin systems (X = 13C or 15N) in molecules undergoing anisotropic rotational diffusion is presented. The original method relies on the fact that the ratio κ2= R2 auto/R2 cross of the transverse auto- and cross-correlated relaxation rates involving the X CSA and the X-H dipolar interaction is independent of parameters related to molecular motion, provided rotational diffusion is isotropic. However, if the overall motion is anisotropic κ2 depends on the anisotropy D∥/D⊥ of rotational diffusion. In this paper, the field dependence of both κ2 and its longitudinal counterpart κ1 = R1 auto/R1 cross are determined. For anisotropic rotational diffusion, our calculations show that the average κav = 1/2 (κ1 + κ2), of the ratios is largely independent of the anisotropy parameter D∥/D⊥. The field dependence of the average ratio κav may thus be utilized to determine CSA tensor parameters by a generalized model-independent approach in the case of molecules with an overall motion described by an axially symmetric rotational diffusion tensor. © Springer 2005.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Chemical shift anisotropy (CSA) tensor parameters have been determined for the protonated carbons of the purine bases in an RNA kissing complex in solution by extending the model-independent approach [Fushman, D., Cowburn, D. (1998) J. Am. Chem. Soc. 120, 7109-7110]. A strategy for determining CSA tensor parameters of heteronuclei in isolated X-H two-spin systems (X = 13C or 15N) in molecules undergoing anisotropic rotational diffusion is presented. The original method relies on the fact that the ratio κ2= R2 auto/R2 cross of the transverse auto- and cross-correlated relaxation rates involving the X CSA and the X-H dipolar interaction is independent of parameters related to molecular motion, provided rotational diffusion is isotropic. However, if the overall motion is anisotropic κ2 depends on the anisotropy D∥/D⊥ of rotational diffusion. In this paper, the field dependence of both κ2 and its longitudinal counterpart κ1 = R1 auto/R1 cross are determined. For anisotropic rotational diffusion, our calculations show that the average κav = 1/2 (κ1 + κ2), of the ratios is largely independent of the anisotropy parameter D∥/D⊥. The field dependence of the average ratio κav may thus be utilized to determine CSA tensor parameters by a generalized model-independent approach in the case of molecules with an overall motion described by an axially symmetric rotational diffusion tensor. © Springer 2005. |
High-resolution NMR spectroscopy in solids by truly magic-angle spinning Article de journal S Antonijevic; G Bodenhausen Angewandte Chemie - International Edition, 44 (19), p. 2935–2938, 2005. @article{Antonijevic:2005, title = {High-resolution NMR spectroscopy in solids by truly magic-angle spinning}, author = {S Antonijevic and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-18844387115&doi=10.1002%2fanie.200463049&partnerID=40&md5=b7909bbb121fddafa7b336a6bb34e172}, doi = {10.1002/anie.200463049}, year = {2005}, date = {2005-01-01}, journal = {Angewandte Chemie - International Edition}, volume = {44}, number = {19}, pages = {2935--2938}, abstract = {Right angles: In solid-state magic-angle spinning (MAS) NMR spectra, the line widths of carbonyl carbon atoms in polycrystalline cholesteryl acetate are found to be as narrow as 0.039 ppm if the magic angle is adjusted very accurately, that is, within ±0.004° (see picture). The line broadening observed for slightly miss-set angles is mostly due to residual chemical shift anisotropy (CSA) interactions. Long spin-echo life times up to T′2 = 3.6 s open the way to sophisticated NMR methods. (Graph Presented) © 2005 Wiley-VCH Verlag GmbH & Co. KGaA.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Right angles: In solid-state magic-angle spinning (MAS) NMR spectra, the line widths of carbonyl carbon atoms in polycrystalline cholesteryl acetate are found to be as narrow as 0.039 ppm if the magic angle is adjusted very accurately, that is, within ±0.004° (see picture). The line broadening observed for slightly miss-set angles is mostly due to residual chemical shift anisotropy (CSA) interactions. Long spin-echo life times up to T′2 = 3.6 s open the way to sophisticated NMR methods. (Graph Presented) © 2005 Wiley-VCH Verlag GmbH & Co. KGaA. |
Temperature-dependent protein backbone dynamics from auto- and cross-correlated NMR relaxation rates Article de journal L Vugmeyster; G Bodenhausen Applied Magnetic Resonance, 28 (1-2), p. 147–163, 2005. @article{Vugmeyster:2005, title = {Temperature-dependent protein backbone dynamics from auto- and cross-correlated NMR relaxation rates}, author = {L Vugmeyster and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-19044381975&doi=10.1007%2fBF03167001&partnerID=40&md5=c57ca4824183415d1342e869182e78d5}, doi = {10.1007/BF03167001}, year = {2005}, date = {2005-01-01}, journal = {Applied Magnetic Resonance}, volume = {28}, number = {1-2}, pages = {147--163}, abstract = {The temperature dependence of nuclear magnetic resonance relaxation rates was investigated for the backbone of 15N/13C labeled human ubiquitin in the temperature range of 20-50°C. The 15N autorelaxation rates give evidence that the potential energy functions for 15N-HN bonds are not quadratic, in agreement with results for other proteins. Cross-correlation rates arising from correlated fluctuations of two 15N-HN dipole-dipole interactions involving successive residues were obtained by the method of Pelupessy et al. (P. Pelupessy, S. Ravindranathan, G. Bodenhausen: J. Biomol. NMR 25, 265-280, 2003). The results suggest the presence of slow internal motions at 50°C. © Springer-Verlag 2005.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The temperature dependence of nuclear magnetic resonance relaxation rates was investigated for the backbone of 15N/13C labeled human ubiquitin in the temperature range of 20-50°C. The 15N autorelaxation rates give evidence that the potential energy functions for 15N-HN bonds are not quadratic, in agreement with results for other proteins. Cross-correlation rates arising from correlated fluctuations of two 15N-HN dipole-dipole interactions involving successive residues were obtained by the method of Pelupessy et al. (P. Pelupessy, S. Ravindranathan, G. Bodenhausen: J. Biomol. NMR 25, 265-280, 2003). The results suggest the presence of slow internal motions at 50°C. © Springer-Verlag 2005. |
Slow motions in nondeuterated proteins: Concerted chemical shift modulations of backbone nuclei Article de journal J Wist; C Perazzolo; G Bodenhausen Applied Magnetic Resonance, 29 (2), p. 251–259, 2005. @article{Wist:2005, title = {Slow motions in nondeuterated proteins: Concerted chemical shift modulations of backbone nuclei}, author = {J Wist and C Perazzolo and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-28844452927&doi=10.1007%2fBF03167012&partnerID=40&md5=df17f258a22c29c20bb38a65750a0e06}, doi = {10.1007/BF03167012}, year = {2005}, date = {2005-01-01}, journal = {Applied Magnetic Resonance}, volume = {29}, number = {2}, pages = {251--259}, abstract = {A simple method designed to measure autorelaxation rates of double- and zero-quantum coherences DQC/ZQCC′N involving a carbonyl C′ and the neighboring amide N nucleus in protein backbones provides valuable insight into slow motions in spite of interference both from the attached amide proton HN and from remote protons such as Hα in nondeuterated proteins. The method has been applied to human ubiquitin. © Springer-Verlag 2005.}, keywords = {}, pubstate = {published}, tppubtype = {article} } A simple method designed to measure autorelaxation rates of double- and zero-quantum coherences DQC/ZQCC′N involving a carbonyl C′ and the neighboring amide N nucleus in protein backbones provides valuable insight into slow motions in spite of interference both from the attached amide proton HN and from remote protons such as Hα in nondeuterated proteins. The method has been applied to human ubiquitin. © Springer-Verlag 2005. |
Slow diffusion by singlet state NMR spectroscopy Article de journal S Cavadini; J Dittmer; S Antonijevic; G Bodenhausen Journal of the American Chemical Society, 127 (45), p. 15744–15748, 2005. @article{Cavadini:2005, title = {Slow diffusion by singlet state NMR spectroscopy}, author = {S Cavadini and J Dittmer and S Antonijevic and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-27844514637&doi=10.1021%2fja052897b&partnerID=40&md5=bd21e78043ec2750a2c3a7ac67c0917c}, doi = {10.1021/ja052897b}, year = {2005}, date = {2005-01-01}, journal = {Journal of the American Chemical Society}, volume = {127}, number = {45}, pages = {15744--15748}, abstract = {Small diffusion coefficients can be measured by using populations of singlet states that have a relaxation time constant, TS, which can be much longer than the longitudinal relaxation time, T1. Spatial information can be encoded with pulsed field gradients in the manner of stimulated echo sequences. Singlet states can be excited via double-quantum coherences to enhance the efficiency of phase encoding and decoding. © 2005 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Small diffusion coefficients can be measured by using populations of singlet states that have a relaxation time constant, TS, which can be much longer than the longitudinal relaxation time, T1. Spatial information can be encoded with pulsed field gradients in the manner of stimulated echo sequences. Singlet states can be excited via double-quantum coherences to enhance the efficiency of phase encoding and decoding. © 2005 American Chemical Society. |
A Markov model for relaxation and exchange in NMR spectroscopy Article de journal D Abergel; A G Palmer III Journal of Physical Chemistry B, 109 (11), p. 4837–4844, 2005. @article{Abergel:2005, title = {A Markov model for relaxation and exchange in NMR spectroscopy}, author = {D Abergel and A G Palmer III}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-15744403441&doi=10.1021%2fjp0458304&partnerID=40&md5=af897563ec09b4f913cfdb6a9e2a226b}, doi = {10.1021/jp0458304}, year = {2005}, date = {2005-01-01}, journal = {Journal of Physical Chemistry B}, volume = {109}, number = {11}, pages = {4837--4844}, abstract = {A two-state Markov noise process for lattice fluctuations and chemical exchange dynamics is used to derive a stochastic Liouville equation describing the evolution of the spin-density operator in nuclear magnetic resonance spectroscopy. Relaxation through lattice fluctuations and chemical exchange processes is incorporated into the theory at the same fundamental level, and the results are valid for all time scales provided that lattice fluctuations are much faster than chemical exchange kinetics. Time-scale separation emerges as an essential feature from the lowest-order perturbation expansion of the average resolvent in the Laplace domain. © 2005 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } A two-state Markov noise process for lattice fluctuations and chemical exchange dynamics is used to derive a stochastic Liouville equation describing the evolution of the spin-density operator in nuclear magnetic resonance spectroscopy. Relaxation through lattice fluctuations and chemical exchange processes is incorporated into the theory at the same fundamental level, and the results are valid for all time scales provided that lattice fluctuations are much faster than chemical exchange kinetics. Time-scale separation emerges as an essential feature from the lowest-order perturbation expansion of the average resolvent in the Laplace domain. © 2005 American Chemical Society. |
2004 |
Triple quantum decoherence under multiple refocusing: Slow correlated chemical shift modulations of C′ and N nuclei in proteins Article de journal J Wist; D Frueh; J R Tolman; G Bodenhausen Journal of Biomolecular NMR, 28 (3), p. 263–272, 2004. @article{Wist:2004, title = {Triple quantum decoherence under multiple refocusing: Slow correlated chemical shift modulations of C′ and N nuclei in proteins}, author = {J Wist and D Frueh and J R Tolman and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-1242317865&doi=10.1023%2fB%3aJNMR.0000013699.48099.38&partnerID=40&md5=71dbf2b587daae202364709b0bac2128}, doi = {10.1023/B:JNMR.0000013699.48099.38}, year = {2004}, date = {2004-01-01}, journal = {Journal of Biomolecular NMR}, volume = {28}, number = {3}, pages = {263--272}, abstract = {A new experiment allows the identification of residues that feature slow conformational exchange in macromolecules. Rotations about dihedral angles that are slower than the global correlation time τc cause a modulation of the isotropic chemical shifts of the nuclei. If these fluctuations are correlated they induce a differential line broadening between three-spin single-quantum and triple-quantum coherences involving three nuclei such as the carbonyl C′, the neighbouring amide nitrogen N and the amide proton HN belonging to a pair of consecutive amino acids. A cross-corelated relaxation rate RC′NCS/CS can be determined that corresponds to the sum of the isotropic and anisotropic contributions to the chemical shift modulations of the carbonyl carbon and nitrogen nuclei. Only the isotropic contributions depend on the pulse repetition rate of a multiple-refocusing sequence. An attenuation of the relaxation rate with increasing pulse repetition rate can therefore be attributed to slow motions. The asparagine N25 residue of ubiquitin, located in the first α-helix, is shown to feature significant slow conformational exchange.}, keywords = {}, pubstate = {published}, tppubtype = {article} } A new experiment allows the identification of residues that feature slow conformational exchange in macromolecules. Rotations about dihedral angles that are slower than the global correlation time τc cause a modulation of the isotropic chemical shifts of the nuclei. If these fluctuations are correlated they induce a differential line broadening between three-spin single-quantum and triple-quantum coherences involving three nuclei such as the carbonyl C′, the neighbouring amide nitrogen N and the amide proton HN belonging to a pair of consecutive amino acids. A cross-corelated relaxation rate RC′NCS/CS can be determined that corresponds to the sum of the isotropic and anisotropic contributions to the chemical shift modulations of the carbonyl carbon and nitrogen nuclei. Only the isotropic contributions depend on the pulse repetition rate of a multiple-refocusing sequence. An attenuation of the relaxation rate with increasing pulse repetition rate can therefore be attributed to slow motions. The asparagine N25 residue of ubiquitin, located in the first α-helix, is shown to feature significant slow conformational exchange. |
Frequency-switched single-transition cross-polarization: A tool for selective experiments in biomolecular NMR Article de journal F Ferrage; T R Eykyn; G Bodenhausen ChemPhysChem, 5 (1), p. 76–84, 2004. @article{Ferrage:2004, title = {Frequency-switched single-transition cross-polarization: A tool for selective experiments in biomolecular NMR}, author = {F Ferrage and T R Eykyn and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-2442499080&doi=10.1002%2fcphc.200300905&partnerID=40&md5=15bb7fd42f64fc588cdfaf1de3a4fc23}, doi = {10.1002/cphc.200300905}, year = {2004}, date = {2004-01-01}, journal = {ChemPhysChem}, volume = {5}, number = {1}, pages = {76--84}, abstract = {Frequency-switched single-transition cross-polarization (FS-ST-CP) provides a versatile tool for selective coherence transfer in heteronuclear NMR of biomolecules such as proteins and nucleic acids. This types of coherence transfer is spin-state-selective and can therefore benefit from the extension of the life-times of selected coherences due to partial cancellation of interfering relaxation mechanisms. The limits of the selectivity of the transfer are discussed by theory and illustrated by experiment. The methods are particularly efficient to obtain quantitative structural and dynamic information for selected residues in medium-sized nitrogen-15 or carbon-13 labeled macromolecules.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Frequency-switched single-transition cross-polarization (FS-ST-CP) provides a versatile tool for selective coherence transfer in heteronuclear NMR of biomolecules such as proteins and nucleic acids. This types of coherence transfer is spin-state-selective and can therefore benefit from the extension of the life-times of selected coherences due to partial cancellation of interfering relaxation mechanisms. The limits of the selectivity of the transfer are discussed by theory and illustrated by experiment. The methods are particularly efficient to obtain quantitative structural and dynamic information for selected residues in medium-sized nitrogen-15 or carbon-13 labeled macromolecules. |
Cross-correlated relaxation in NMR of macromolecules in the presence of fast and slow internal dynamics Article de journal L Vugmeyster; P Pelupessy; B E Vugmeister; D Abergel; G Bodenhausen Comptes Rendus Physique, 5 (3), p. 377–386, 2004. @article{Vugmeyster:2004, title = {Cross-correlated relaxation in NMR of macromolecules in the presence of fast and slow internal dynamics}, author = {L Vugmeyster and P Pelupessy and B E Vugmeister and D Abergel and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-2442500664&doi=10.1016%2fj.crhy.2004.02.004&partnerID=40&md5=058f478a0487336127f7cb06974b859f}, doi = {10.1016/j.crhy.2004.02.004}, year = {2004}, date = {2004-01-01}, journal = {Comptes Rendus Physique}, volume = {5}, number = {3}, pages = {377--386}, abstract = {In this paper we present an analysis of correlation and spectral density functions involved in autorelaxation and cross-correlated relaxation in the magnetic resonance of macromolecules. Internal dynamics of the macromolecule are described in terms of two distinct fluctuation processes with different, slow and fast, correlation times. The approach developed in this work takes into account the possible coupling between both fluctuating internal processes. © 2004 Acad\'{e}mie des sciences. Published by Elsevier SAS. All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } In this paper we present an analysis of correlation and spectral density functions involved in autorelaxation and cross-correlated relaxation in the magnetic resonance of macromolecules. Internal dynamics of the macromolecule are described in terms of two distinct fluctuation processes with different, slow and fast, correlation times. The approach developed in this work takes into account the possible coupling between both fluctuating internal processes. © 2004 Académie des sciences. Published by Elsevier SAS. All rights reserved. |
A simple model for NMR relaxation in the presence of internal motions with dynamical coupling Article de journal D Abergel; G Bodenhausen Journal of Chemical Physics, 121 (2), p. 761–768, 2004. @article{Abergel:2004, title = {A simple model for NMR relaxation in the presence of internal motions with dynamical coupling}, author = {D Abergel and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-3242683501&doi=10.1063%2f1.1756867&partnerID=40&md5=8b7c4df05c38074ec58b2db8fd9dc701}, doi = {10.1063/1.1756867}, year = {2004}, date = {2004-01-01}, journal = {Journal of Chemical Physics}, volume = {121}, number = {2}, pages = {761--768}, abstract = {A simple model for NMR relaxation was investigated in the presence of internal motions with dynamical coupling. In the model, an interaction vector u undergoes a rotational diffusion motion both in its own, intrinsic, diffusion potential and in a coupling potential through which it is dynamically linked to a neighboring vector v. A linearized Langevin approach allows the derivation of explicit expressions for the correlation functions and for the corresponding order parameters. It was observed that the lattice affects the relaxation times measured by NMR through the spectral density function J(ω).}, keywords = {}, pubstate = {published}, tppubtype = {article} } A simple model for NMR relaxation was investigated in the presence of internal motions with dynamical coupling. In the model, an interaction vector u undergoes a rotational diffusion motion both in its own, intrinsic, diffusion potential and in a coupling potential through which it is dynamically linked to a neighboring vector v. A linearized Langevin approach allows the derivation of explicit expressions for the correlation functions and for the corresponding order parameters. It was observed that the lattice affects the relaxation times measured by NMR through the spectral density function J(ω). |
Determination chemical shift anisotropy tensors of carbonyl nuclei in proteins through cross-correlated relaxation in NMR Article de journal F Cisnetti; K Loth; P Pelupessy; G Bodenhausen ChemPhysChem, 5 (6), p. 807–814, 2004. @article{Cisnetti:2004, title = {Determination chemical shift anisotropy tensors of carbonyl nuclei in proteins through cross-correlated relaxation in NMR}, author = {F Cisnetti and K Loth and P Pelupessy and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-3142693910&doi=10.1002%2fcphc.200301041&partnerID=40&md5=afd2670da525e0405b8099e636f12207}, doi = {10.1002/cphc.200301041}, year = {2004}, date = {2004-01-01}, journal = {ChemPhysChem}, volume = {5}, number = {6}, pages = {807--814}, abstract = {The principal components and orientations of the chemical shift anisotropy (CSA) tensors of nearly all C carbonyl nuclei in a small protein have been determined in isotropic solution by a combination of three complementary cross-correlation measurements.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The principal components and orientations of the chemical shift anisotropy (CSA) tensors of nearly all C carbonyl nuclei in a small protein have been determined in isotropic solution by a combination of three complementary cross-correlation measurements. |
Evidence for Slow Motion in Proteins by Multiple Refocusing of Heteronuclear Nitrogen/Proton Multiple Quantum Coherences in NMR Article de journal J Dittmer; G Bodenhausen Journal of the American Chemical Society, 126 (5), p. 1314–1315, 2004. @article{Dittmer:2004, title = {Evidence for Slow Motion in Proteins by Multiple Refocusing of Heteronuclear Nitrogen/Proton Multiple Quantum Coherences in NMR}, author = {J Dittmer and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-1042288192&doi=10.1021%2fja0386243&partnerID=40&md5=30e744bc866b3fe562a6e38e36815c2d}, doi = {10.1021/ja0386243}, year = {2004}, date = {2004-01-01}, journal = {Journal of the American Chemical Society}, volume = {126}, number = {5}, pages = {1314--1315}, abstract = {A novel NMR method characterizes slow motions in proteins by multiple refocusing of double- and zero-quantum coherences of amide protons and nitrogen-15 nuclei. If both nuclei experience changes in their isotropic chemical shifts because of internal motions on slow time scales (μs - ms), this leads to a difference in the relaxation rates of double- and zero-quantum coherences. This is due to CSM/CSM (chemical shift modulation) cross-correlation effects that are related to the well-known chemical exchange contribution Rex to the decay rate R2 = 1/T2 of nitrogen-15 nuclei. The CSM/CSM contributions can be distinguished from other mechanisms through their dependence on the repetition rate of a Carr-Purcell-Meiboom-Gill (CPMG) multiple refocusing sequence. In ubiquitin, motional processes can be identified that could hitherto not be observed by conventional CPMG nitrogen-15 NMR. Copyright © 2004 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } A novel NMR method characterizes slow motions in proteins by multiple refocusing of double- and zero-quantum coherences of amide protons and nitrogen-15 nuclei. If both nuclei experience changes in their isotropic chemical shifts because of internal motions on slow time scales (μs - ms), this leads to a difference in the relaxation rates of double- and zero-quantum coherences. This is due to CSM/CSM (chemical shift modulation) cross-correlation effects that are related to the well-known chemical exchange contribution Rex to the decay rate R2 = 1/T2 of nitrogen-15 nuclei. The CSM/CSM contributions can be distinguished from other mechanisms through their dependence on the repetition rate of a Carr-Purcell-Meiboom-Gill (CPMG) multiple refocusing sequence. In ubiquitin, motional processes can be identified that could hitherto not be observed by conventional CPMG nitrogen-15 NMR. Copyright © 2004 American Chemical Society. |
Evidence of slow motions by cross-correlated chemical shift modulation in deuterated and protonated proteins Article de journal L Vugmeyster; C Perazzolo; J Wist; D Frueh; G Bodenhausen Journal of Biomolecular NMR, 28 (2), p. 173–177, 2004. @article{Vugmeyster:2004a, title = {Evidence of slow motions by cross-correlated chemical shift modulation in deuterated and protonated proteins}, author = {L Vugmeyster and C Perazzolo and J Wist and D Frueh and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-1242331371&doi=10.1023%2fB%3aJNMR.0000013828.58005.8a&partnerID=40&md5=b94ab35529939a369abf367c9608ad03}, doi = {10.1023/B:JNMR.0000013828.58005.8a}, year = {2004}, date = {2004-01-01}, journal = {Journal of Biomolecular NMR}, volume = {28}, number = {2}, pages = {173--177}, abstract = {Cross-correlated fluctuations of isotropic chemical shifts can provide evidence for slow motions in biomolecules. Slow side-chain dynamics have been investigated in 15N and 13C enriched ubiquitin by monitoring the relaxation of Cα-Cβ two-spin coherences (Frueh et al., 2001). This method, which had hitherto been demonstrated only for protonated ubiquitin, has now been applied to both protonated and deuterated proteins. Deuteration reduces the dipole-dipole contributions to the DD/DD cross-correlation, thus facilitating the observation of subtle effects due to cross-correlation of the fluctuations of the isotropic 13C chemical shifts. The decays of double- and zero-quantum coherences are significantly slower in the deuterated protein than in the protonated sample. Slow motions are found both in loops and in secondary structure elements.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Cross-correlated fluctuations of isotropic chemical shifts can provide evidence for slow motions in biomolecules. Slow side-chain dynamics have been investigated in 15N and 13C enriched ubiquitin by monitoring the relaxation of Cα-Cβ two-spin coherences (Frueh et al., 2001). This method, which had hitherto been demonstrated only for protonated ubiquitin, has now been applied to both protonated and deuterated proteins. Deuteration reduces the dipole-dipole contributions to the DD/DD cross-correlation, thus facilitating the observation of subtle effects due to cross-correlation of the fluctuations of the isotropic 13C chemical shifts. The decays of double- and zero-quantum coherences are significantly slower in the deuterated protein than in the protonated sample. Slow motions are found both in loops and in secondary structure elements. |
Multiple refocusing in NMR spectroscopy: Compensation of pulse imperfections by scalar couplings Article de journal J Dittmer; G Bodenhausen ChemPhysChem, 5 (11), p. 1750–1754, 2004. @article{Dittmer:2004a, title = {Multiple refocusing in NMR spectroscopy: Compensation of pulse imperfections by scalar couplings}, author = {J Dittmer and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-9644275488&doi=10.1002%2fcphc.200400073&partnerID=40&md5=d5f41d445b925d79d05ee1ca4e35c156}, doi = {10.1002/cphc.200400073}, year = {2004}, date = {2004-01-01}, journal = {ChemPhysChem}, volume = {5}, number = {11}, pages = {1750--1754}, abstract = {When applying multiple refocusing pulses to characterize the cross-correlated relaxation of heteronuclear multiple quantum coherence 2N xHx in biomolecules, the unavoidable effects of pulse imperfections are compensated by the scalar couplings between nitrogen atoms and protons. The experiment, which is useful as a tool for studying slow internal dynamics of biomolecules, greatly benefits from this compensation. The underlying effect is a manifestation of an interchange between three non-commuting components of the density operator. One perturbing Hamiltonian is counteracted by another, which leads to a nearly complete suppression of the perturbation. The effect proves to be an example of a hitherto unknown phenomenon in NMR spectroscopy.}, keywords = {}, pubstate = {published}, tppubtype = {article} } When applying multiple refocusing pulses to characterize the cross-correlated relaxation of heteronuclear multiple quantum coherence 2N xHx in biomolecules, the unavoidable effects of pulse imperfections are compensated by the scalar couplings between nitrogen atoms and protons. The experiment, which is useful as a tool for studying slow internal dynamics of biomolecules, greatly benefits from this compensation. The underlying effect is a manifestation of an interchange between three non-commuting components of the density operator. One perturbing Hamiltonian is counteracted by another, which leads to a nearly complete suppression of the perturbation. The effect proves to be an example of a hitherto unknown phenomenon in NMR spectroscopy. |
Modern magnetic resonance: A hidden treasure of physical chemistry? Article de journal G Bodenhausen ChemPhysChem, 5 (6), p. 768–770, 2004. @article{Bodenhausen:2004, title = {Modern magnetic resonance: A hidden treasure of physical chemistry?}, author = {G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-3142739329&doi=10.1002%2fcphc.200420002&partnerID=40&md5=d838ac0dc289f843cc490cf622da06c8}, doi = {10.1002/cphc.200420002}, year = {2004}, date = {2004-01-01}, journal = {ChemPhysChem}, volume = {5}, number = {6}, pages = {768--770}, keywords = {}, pubstate = {published}, tppubtype = {article} } |
2003 |
Slow diffusion of macromolecular assemblies by a new pulsed field gradient NMR method Article de journal F Ferrage; M Zoonens; D E Warschawski; J -L Popot; G Bodenhausen Journal of the American Chemical Society, 125 (9), p. 2541–2545, 2003. @article{Ferrage:2003, title = {Slow diffusion of macromolecular assemblies by a new pulsed field gradient NMR method}, author = {F Ferrage and M Zoonens and D E Warschawski and J -L Popot and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0242669339&doi=10.1021%2fja0211407&partnerID=40&md5=754f14f13b7ab39866044af53f46b0ae}, doi = {10.1021/ja0211407}, year = {2003}, date = {2003-01-01}, journal = {Journal of the American Chemical Society}, volume = {125}, number = {9}, pages = {2541--2545}, abstract = {The translational diffusion coefficient of an integral membrane protein/surfactant complex has been measured using a novel pulsed field gradient NMR method. In this new approach, the information about the localization of the molecules is temporarily stored in the form of longitudinal magnetization of isotopes with long spin-lattice relaxation times. This allows one to increase the duration of the diffusion interval by about 1 order of magnitude. Unlike standard proton NMR methods using pulsed field gradients and stimulated echoes, the new method can be applied to macromolecular assemblies with diffusion coefficients well below 10-10 m2 s-1, corresponding to masses in excess of 25 kDa in aqueous solution at room temperature. The method was illustrated by application to a water-soluble complex of tOmpA, the hydrophobic transmembrane domain of bacterial outer membrane protein A, with the detergent octyl-tetraoxyethylene (C8E4; overall mass of complex ∼45 kDa). The diffusion coefficient was found to be D = (4.99 ± 0.07) × 10-11 m2 s-1, consistent with measurements by size exclusion chromatography and by ultracentrifugation. The method has also been applied to a solution of recombinant human tRNA3Lys, which has a molecular mass of 24 kDa, and the diffusion coefficient D = (1.05 ± 0.015) × 10-10 m2 s-1.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The translational diffusion coefficient of an integral membrane protein/surfactant complex has been measured using a novel pulsed field gradient NMR method. In this new approach, the information about the localization of the molecules is temporarily stored in the form of longitudinal magnetization of isotopes with long spin-lattice relaxation times. This allows one to increase the duration of the diffusion interval by about 1 order of magnitude. Unlike standard proton NMR methods using pulsed field gradients and stimulated echoes, the new method can be applied to macromolecular assemblies with diffusion coefficients well below 10-10 m2 s-1, corresponding to masses in excess of 25 kDa in aqueous solution at room temperature. The method was illustrated by application to a water-soluble complex of tOmpA, the hydrophobic transmembrane domain of bacterial outer membrane protein A, with the detergent octyl-tetraoxyethylene (C8E4; overall mass of complex ∼45 kDa). The diffusion coefficient was found to be D = (4.99 ± 0.07) × 10-11 m2 s-1, consistent with measurements by size exclusion chromatography and by ultracentrifugation. The method has also been applied to a solution of recombinant human tRNA3Lys, which has a molecular mass of 24 kDa, and the diffusion coefficient D = (1.05 ± 0.015) × 10-10 m2 s-1. |
Cross correlations between 13C-1H dipolar interactions and 15N chemical shift anisotropy in nucleic acids Article de journal S Ravindranathan; C -H Kim; G Bodenhausen Journal of Biomolecular NMR, 27 (4), p. 365–375, 2003. @article{Ravindranathan:2003, title = {Cross correlations between 13C-1H dipolar interactions and 15N chemical shift anisotropy in nucleic acids}, author = {S Ravindranathan and C -H Kim and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0142167984&doi=10.1023%2fA%3a1025827017409&partnerID=40&md5=392313a16be030fe5ac038d3c5038f1c}, doi = {10.1023/A:1025827017409}, year = {2003}, date = {2003-01-01}, journal = {Journal of Biomolecular NMR}, volume = {27}, number = {4}, pages = {365--375}, abstract = {Two sets of cross-correlated relaxation rates involving chemical shift anisotropy and dipolar interactions have been measured in an RNA kissing complex. In one case, both the CSA and dipolar interaction tensors ate located on the same nucleotide base and are rigidly fixed with respect to each other. In the other case, the CSA tensor is located on the nucleotide base whereas the dipolar interaction is located on the adjoining ribose unit. Analysis of the measured rates in terms of isotropic or anisotropic rotational diffusion has been carried out for both cases. A marked difference between the two models is observed for the cross-correlation rates involving rigidly fixed spin interactions. The influence of internal motions about the glycosidic linkage between the nucleotide base and the ribose unit on cross-correlated relaxation rates has been estimated by applying a model of restricted rotational diffusion. Local motions seem to have a more pronounced effect on cross-correlated relaxation rates when the two spin interactions are not rigidly fixed with respect to each other.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Two sets of cross-correlated relaxation rates involving chemical shift anisotropy and dipolar interactions have been measured in an RNA kissing complex. In one case, both the CSA and dipolar interaction tensors ate located on the same nucleotide base and are rigidly fixed with respect to each other. In the other case, the CSA tensor is located on the nucleotide base whereas the dipolar interaction is located on the adjoining ribose unit. Analysis of the measured rates in terms of isotropic or anisotropic rotational diffusion has been carried out for both cases. A marked difference between the two models is observed for the cross-correlation rates involving rigidly fixed spin interactions. The influence of internal motions about the glycosidic linkage between the nucleotide base and the ribose unit on cross-correlated relaxation rates has been estimated by applying a model of restricted rotational diffusion. Local motions seem to have a more pronounced effect on cross-correlated relaxation rates when the two spin interactions are not rigidly fixed with respect to each other. |
Correlated motions of successive amide N-Ħ bonds in proteins Article de journal P Pelupessy; S Ravindranathan; G Bodenhausen Journal of Biomolecular NMR, 25 (4), p. 265–280, 2003. @article{Pelupessy:2003, title = {Correlated motions of successive amide N-{H} bonds in proteins}, author = {P Pelupessy and S Ravindranathan and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0037510001&doi=10.1023%2fA%3a1023076212536&partnerID=40&md5=5d513564f1f2acccf21470ed5db5d00c}, doi = {10.1023/A:1023076212536}, year = {2003}, date = {2003-01-01}, journal = {Journal of Biomolecular NMR}, volume = {25}, number = {4}, pages = {265--280}, abstract = {New nuclear magnetic resonance (NMR) methods are described for the measurement of cross-correlation rates of zero- and double-quantum coherences involving two nitrogen nuclei belonging to successive amino acids in proteins and peptides. Rates due to the concerted fluctuations of two NHN dipole-dipole interactions and to the correlated modulations of two nitrogen chemical shift anisotropies have been obtained in a sample of doubly labeled Ubiquitin. Ambiguities in the determination of dihedral angles can be lifted by comparison of different rates. By defining a heuristic order parameter, experimental rates can be compared with those expected for a rigid molecule. The cross-correlation order parameter that can be derived from a model-free approach can be separated into structural and dynamic contribution.}, keywords = {}, pubstate = {published}, tppubtype = {article} } New nuclear magnetic resonance (NMR) methods are described for the measurement of cross-correlation rates of zero- and double-quantum coherences involving two nitrogen nuclei belonging to successive amino acids in proteins and peptides. Rates due to the concerted fluctuations of two NHN dipole-dipole interactions and to the correlated modulations of two nitrogen chemical shift anisotropies have been obtained in a sample of doubly labeled Ubiquitin. Ambiguities in the determination of dihedral angles can be lifted by comparison of different rates. By defining a heuristic order parameter, experimental rates can be compared with those expected for a rigid molecule. The cross-correlation order parameter that can be derived from a model-free approach can be separated into structural and dynamic contribution. |
Hydrogen bonds lengths in nucleic acids estimated from longitudinal nitrogen-15 relaxation Article de journal D Bytchenkoff; G Bodenhausen Journal of Magnetic Resonance, 165 (1), p. 1–8, 2003. @article{Bytchenkoff:2003, title = {Hydrogen bonds lengths in nucleic acids estimated from longitudinal nitrogen-15 relaxation}, author = {D Bytchenkoff and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0142075320&doi=10.1016%2fS1090-7807%2803%2900271-4&partnerID=40&md5=6184048df04b99d892d8968b30368727}, doi = {10.1016/S1090-7807(03)00271-4}, year = {2003}, date = {2003-01-01}, journal = {Journal of Magnetic Resonance}, volume = {165}, number = {1}, pages = {1--8}, abstract = {A new NMR method has been designed for the measurement of the longitudinal relaxation rates of both donor and acceptor nitrogen-15 nuclei in Watson-Crick base pairs in 15N-enriched nucleic acids. The experiment was applied to a 22-nucleotide RNA hairpin. The lengths of four hydrogen bonds could be estimated from the longitudinal relaxation rates. © 2003 Elsevier Inc. All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } A new NMR method has been designed for the measurement of the longitudinal relaxation rates of both donor and acceptor nitrogen-15 nuclei in Watson-Crick base pairs in 15N-enriched nucleic acids. The experiment was applied to a 22-nucleotide RNA hairpin. The lengths of four hydrogen bonds could be estimated from the longitudinal relaxation rates. © 2003 Elsevier Inc. All rights reserved. |
Similarities between intra- and intermolecular hydrogen bonds in RNA kissing complexes found by means of cross-correlated relaxation Article de journal J Dittmer; C -H Kim; G Bodenhausen Journal of Biomolecular NMR, 26 (3), p. 259–275, 2003. @article{Dittmer:2003, title = {Similarities between intra- and intermolecular hydrogen bonds in RNA kissing complexes found by means of cross-correlated relaxation}, author = {J Dittmer and C -H Kim and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0037731196&doi=10.1023%2fA%3a1023829129379&partnerID=40&md5=5a31412cf7227f234a0a74fb55ff1730}, doi = {10.1023/A:1023829129379}, year = {2003}, date = {2003-01-01}, journal = {Journal of Biomolecular NMR}, volume = {26}, number = {3}, pages = {259--275}, abstract = {The bond lengths and dynamics of intra- and intermolecular hydrogen bonds in an RNA kissing complex have been characterized by determining the NMR relaxation rates of various double- and triple-quantum coherences that involve an imino proton and two neighboring nitrogen-15 nuclei belonging to opposite bases. New experiments allow one to determine the chemical shift anisotropy of the imino protons. The bond lengths derived from dipolar relaxation and the lack of modulations of the nitrogen chemical shifts indicate that the intermolecular hydrogen bonds which hold the kissing complex together are very similar to the intramolecular hydrogen bonds in the double-stranded stem of the RNA.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The bond lengths and dynamics of intra- and intermolecular hydrogen bonds in an RNA kissing complex have been characterized by determining the NMR relaxation rates of various double- and triple-quantum coherences that involve an imino proton and two neighboring nitrogen-15 nuclei belonging to opposite bases. New experiments allow one to determine the chemical shift anisotropy of the imino protons. The bond lengths derived from dipolar relaxation and the lack of modulations of the nitrogen chemical shifts indicate that the intermolecular hydrogen bonds which hold the kissing complex together are very similar to the intramolecular hydrogen bonds in the double-stranded stem of the RNA. |
Transferred cross-relaxation and cross-correlation in NMR: Effects of intermediate exchange on the determination of the conformation of bound ligands Article de journal S Ravindranathan; J -M Mallet; P Sinay; G Bodenhausen Journal of Magnetic Resonance, 163 (2), p. 199–207, 2003. @article{Ravindranathan:2003a, title = {Transferred cross-relaxation and cross-correlation in NMR: Effects of intermediate exchange on the determination of the conformation of bound ligands}, author = {S Ravindranathan and J -M Mallet and P Sinay and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0042531553&doi=10.1016%2fS1090-7807%2803%2900156-3&partnerID=40&md5=c182cd7c7d31fd4b7c83f71b4a3626ec}, doi = {10.1016/S1090-7807(03)00156-3}, year = {2003}, date = {2003-01-01}, journal = {Journal of Magnetic Resonance}, volume = {163}, number = {2}, pages = {199--207}, abstract = {Exchange transferred effects in solution-state NMR experiments allow one to determine the conformation of ligands that are weakly bound to macromolecules. Exchange-transferred nuclear Overhauser effect spectroscopy ('TR-NOESY') provides information about internuclear distances in a ligand in the bound state. Recently the possibility of obtaining dihedral angle information from a ligand in the bound state by exchange-transferred cross-correlation spectroscopy ('TR-CCSY') has been reported. In both cases the analysis of the signal amplitudes is usually based on the assumption that rapid exchange occurs between the free and bound forms of the ligand. In this paper we show that the fast exchange condition is not easily attained for observing exchange-transferred cross-correlation effects even in systems where exchange-transferred NOE can be observed. Extensive simulations based on analytical expressions for signal intensities corresponding to fast, intermediate, and slow chemical exchange have been carried out on a test system to determine the exchange regimes in which the fast exchange condition can be fulfilled for successfully implementing TR-NOESY and TR-CCSY. © 2003 Elsevier Science (USA). All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Exchange transferred effects in solution-state NMR experiments allow one to determine the conformation of ligands that are weakly bound to macromolecules. Exchange-transferred nuclear Overhauser effect spectroscopy ('TR-NOESY') provides information about internuclear distances in a ligand in the bound state. Recently the possibility of obtaining dihedral angle information from a ligand in the bound state by exchange-transferred cross-correlation spectroscopy ('TR-CCSY') has been reported. In both cases the analysis of the signal amplitudes is usually based on the assumption that rapid exchange occurs between the free and bound forms of the ligand. In this paper we show that the fast exchange condition is not easily attained for observing exchange-transferred cross-correlation effects even in systems where exchange-transferred NOE can be observed. Extensive simulations based on analytical expressions for signal intensities corresponding to fast, intermediate, and slow chemical exchange have been carried out on a test system to determine the exchange regimes in which the fast exchange condition can be fulfilled for successfully implementing TR-NOESY and TR-CCSY. © 2003 Elsevier Science (USA). All rights reserved. |
Symmetrical reconversion: Measuring cross-correlation rates with enhanced accuracy Article de journal P Pelupessy; G M Espallargas; G Bodenhausen Journal of Magnetic Resonance, 161 (2), p. 258–264, 2003. @article{Pelupessy:2003b, title = {Symmetrical reconversion: Measuring cross-correlation rates with enhanced accuracy}, author = {P Pelupessy and G M Espallargas and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0037812457&doi=10.1016%2fS1090-7807%2802%2900190-8&partnerID=40&md5=9948cd3928771980570c0f0c6424e5a0}, doi = {10.1016/S1090-7807(02)00190-8}, year = {2003}, date = {2003-01-01}, journal = {Journal of Magnetic Resonance}, volume = {161}, number = {2}, pages = {258--264}, abstract = {A new strategy has been developed to measure cross-correlation rates with much enhanced accuracy. The method relies on the use of four complementary experiments. Errors due to pulse miscalibration and to uncontrolled attenuation factors associated with relaxation are cancelled out. Problems due to violations of the secular approximation are greatly alleviated. The method has been applied to the measurement of N/NH (CSA/DD) cross-correlated relaxation rates in human ubiquitin. © 2003 Elsevier Science (USA). All rights reserved.}, keywords = {}, pubstate = {published}, tppubtype = {article} } A new strategy has been developed to measure cross-correlation rates with much enhanced accuracy. The method relies on the use of four complementary experiments. Errors due to pulse miscalibration and to uncontrolled attenuation factors associated with relaxation are cancelled out. Problems due to violations of the secular approximation are greatly alleviated. The method has been applied to the measurement of N/NH (CSA/DD) cross-correlated relaxation rates in human ubiquitin. © 2003 Elsevier Science (USA). All rights reserved. |
2002 |
Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA Article de journal D Bytchenkoff; E Chiarparin; D Früh; S Rüdisser; G Bodenhausen Magnetic Resonance in Chemistry, 40 (5), p. 377–379, 2002. @article{Bytchenkoff:2002, title = {Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA}, author = {D Bytchenkoff and E Chiarparin and D Fr\"{u}h and S R\"{u}disser and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0037935797&doi=10.1002%2fmrc.1018&partnerID=40&md5=b01f0624f7007a556a8f852906c902b6}, doi = {10.1002/mrc.1018}, year = {2002}, date = {2002-01-01}, journal = {Magnetic Resonance in Chemistry}, volume = {40}, number = {5}, pages = {377--379}, abstract = {The temperature dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of 2hJ(N,N) was observed to decrease monotonically for all four base pairs with increasing temperature. The temperature dependence of 2hJ(N,N) was found to be more pronounced for the A-U base pair than for G-C base pairs. An earlier study of cross-correlation effects at 296 K appeared to indicate a reduced mobility of the A-U base pair, as evidenced by small contributions of chemical shift modulation to relaxation rates. Copyright © 2002 John Wiley & Sons, Ltd.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The temperature dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of 2hJ(N,N) was observed to decrease monotonically for all four base pairs with increasing temperature. The temperature dependence of 2hJ(N,N) was found to be more pronounced for the A-U base pair than for G-C base pairs. An earlier study of cross-correlation effects at 296 K appeared to indicate a reduced mobility of the A-U base pair, as evidenced by small contributions of chemical shift modulation to relaxation rates. Copyright © 2002 John Wiley & Sons, Ltd. |
Highly selective excitation in biomolecular NMR by frequency-switched single-transition cross-polarization Article de journal F Ferrage; T R Eykyn; G Bodenhausen Journal of the American Chemical Society, 124 (10), p. 2076–2077, 2002. @article{Ferrage:2002, title = {Highly selective excitation in biomolecular NMR by frequency-switched single-transition cross-polarization}, author = {F Ferrage and T R Eykyn and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0037070539&doi=10.1021%2fja012452x&partnerID=40&md5=09679a64024130c23edb55660347b015}, doi = {10.1021/ja012452x}, year = {2002}, date = {2002-01-01}, journal = {Journal of the American Chemical Society}, volume = {124}, number = {10}, pages = {2076--2077}, abstract = {A new method for selective excitation in biomolecular NMR uses two-fold single-transition cross-polarization between protons and nitrogen-15 or carbon-13 nuclei. Switching the frequencies between the forward and backward transfer steps allows one to select a multiplet pattern that is associated with a single pair of spins in a medium-size protein. The efficiency of the transfer benefits from so-called TROSY line-narrowing effects which arise from interference between relaxation mechanisms. Copyright © 2002 American Chemical Society.}, keywords = {}, pubstate = {published}, tppubtype = {article} } A new method for selective excitation in biomolecular NMR uses two-fold single-transition cross-polarization between protons and nitrogen-15 or carbon-13 nuclei. Switching the frequencies between the forward and backward transfer steps allows one to select a multiplet pattern that is associated with a single pair of spins in a medium-size protein. The efficiency of the transfer benefits from so-called TROSY line-narrowing effects which arise from interference between relaxation mechanisms. Copyright © 2002 American Chemical Society. |
Quasi-isotropic single-transition cross-polarization in nuclear magnetic resonance Article de journal T R Eykyn; F Ferrage; G Bodenhausen Journal of Chemical Physics, 116 (23), p. 10041–10050, 2002. @article{Eykyn:2002, title = {Quasi-isotropic single-transition cross-polarization in nuclear magnetic resonance}, author = {T R Eykyn and F Ferrage and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0037162260&doi=10.1063%2f1.1477176&partnerID=40&md5=fb47c40fc7f3bf8f438fcd34eeaf7ec8}, doi = {10.1063/1.1477176}, year = {2002}, date = {2002-01-01}, journal = {Journal of Chemical Physics}, volume = {116}, number = {23}, pages = {10041--10050}, abstract = {An investigation of the theory of single-transition (ST) cross-polarization (CP) in nuclear magnetic resonance (NMR) was presented and verified by experimental evidence. Investigation was done under the influence of two extremely weak constant-amplitude radio frequency (rf) fields applied to two connected single-transition coherences which shared a common eigenstate. The results showed that ST-CP was quasi-isotropic in the sense that all three components, Sx, Sy and Sz, of the angular momentum of a spin were transfered simultaneously to all three components Ix, Iy and Iz.}, keywords = {}, pubstate = {published}, tppubtype = {article} } An investigation of the theory of single-transition (ST) cross-polarization (CP) in nuclear magnetic resonance (NMR) was presented and verified by experimental evidence. Investigation was done under the influence of two extremely weak constant-amplitude radio frequency (rf) fields applied to two connected single-transition coherences which shared a common eigenstate. The results showed that ST-CP was quasi-isotropic in the sense that all three components, Sx, Sy and Sz, of the angular momentum of a spin were transfered simultaneously to all three components Ix, Iy and Iz. |
Synthesis and properties of water-soluble gold colloids covalently derivatized with neutral polymer monolayers Article de journal C Mangeney; F Ferrage; I Aujard; V Artzner; L Jullien; O Ouari; E Djouhar Rékai; A Laschewsky; I Vikholm; J W Sadowski Journal of the American Chemical Society, 124 (20), p. 5811–5821, 2002. @article{Mangeney:2002, title = {Synthesis and properties of water-soluble gold colloids covalently derivatized with neutral polymer monolayers}, author = {C Mangeney and F Ferrage and I Aujard and V Artzner and L Jullien and O Ouari and E Djouhar R\'{e}kai and A Laschewsky and I Vikholm and J W Sadowski}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0037157185&doi=10.1021%2fja010796h&partnerID=40&md5=0866a4217a986ce8c43d1a84df5645a0}, doi = {10.1021/ja010796h}, year = {2002}, date = {2002-01-01}, journal = {Journal of the American Chemical Society}, volume = {124}, number = {20}, pages = {5811--5821}, abstract = {Citrate-capped gold nanoparticles as well as planar gold surfaces can be efficiently grafted with a covalently attached polymer monolayer a few nanometers thick, by simple contact of the metal surface with dilute aqueous solutions of hydrophilic polymers that are end-capped with disulfide moieties, as shown by UV/vis absorption, dynamic light scattering, and surface plasmon resonance studies. The hydrophilic polymer-coated gold colloids can be freeze-dried and stored as powders that can be subsequently dissolved to yield stable aqueous dispersions, even at very large concentrations. They allow for applying filtrations, gel permeation chromatography, or centrifugation. They do not suffer from undesirable nonspecific adsorption of proteins while allowing the diffusion of small species within the hydrogel surface coating. In addition, specific properties of the original hydrophilic polymers are retained such as a lower critical solution temperature. The latter feature could be useful to enhance optical responses of functionalized gold surfaces toward interaction with various substrates.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Citrate-capped gold nanoparticles as well as planar gold surfaces can be efficiently grafted with a covalently attached polymer monolayer a few nanometers thick, by simple contact of the metal surface with dilute aqueous solutions of hydrophilic polymers that are end-capped with disulfide moieties, as shown by UV/vis absorption, dynamic light scattering, and surface plasmon resonance studies. The hydrophilic polymer-coated gold colloids can be freeze-dried and stored as powders that can be subsequently dissolved to yield stable aqueous dispersions, even at very large concentrations. They allow for applying filtrations, gel permeation chromatography, or centrifugation. They do not suffer from undesirable nonspecific adsorption of proteins while allowing the diffusion of small species within the hydrogel surface coating. In addition, specific properties of the original hydrophilic polymers are retained such as a lower critical solution temperature. The latter feature could be useful to enhance optical responses of functionalized gold surfaces toward interaction with various substrates. |
Accurate measurement of residual dipolar couplings in anisotropic phase Article de journal B Cutting; J R Tolman; S Nanchen; G Bodenhausen Journal of Biomolecular NMR, 23 (3), p. 195–200, 2002. @article{Cutting:2002, title = {Accurate measurement of residual dipolar couplings in anisotropic phase}, author = {B Cutting and J R Tolman and S Nanchen and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0036367686&doi=10.1023%2fA%3a1019800511340&partnerID=40&md5=a7b5783167f0dd44b280ae5255521b11}, doi = {10.1023/A:1019800511340}, year = {2002}, date = {2002-01-01}, journal = {Journal of Biomolecular NMR}, volume = {23}, number = {3}, pages = {195--200}, abstract = {The determination of residual dipolar couplings (RDCs) by quantitative J spectroscopy methods such as Heteronuclear Single Quantum Correlation with Phase Encoded Coupling (HSQC-PEC) is prone to systematic errors that may be caused by differential attenuation during the conversion of orthogonal density operator components into observable terms. The attenuation may be caused by miscalibration of radio-frequency pulses and by relaxation effects. A simple method is presented that allows one to remove most of these systematic errors without losses in sensitivity or resolution.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The determination of residual dipolar couplings (RDCs) by quantitative J spectroscopy methods such as Heteronuclear Single Quantum Correlation with Phase Encoded Coupling (HSQC-PEC) is prone to systematic errors that may be caused by differential attenuation during the conversion of orthogonal density operator components into observable terms. The attenuation may be caused by miscalibration of radio-frequency pulses and by relaxation effects. A simple method is presented that allows one to remove most of these systematic errors without losses in sensitivity or resolution. |
Measurement of long-range cross-correlation rates using a combination of single- and multiple-quantum NMR spectroscopy in one experiment Article de journal D Früh; E Chiarparin; P Pelupessy; G Bodenhausen Journal of the American Chemical Society, 124 (15), p. 4050–4057, 2002. @article{Fruh:2002, title = {Measurement of long-range cross-correlation rates using a combination of single- and multiple-quantum NMR spectroscopy in one experiment}, author = {D Fr\"{u}h and E Chiarparin and P Pelupessy and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0037123170&doi=10.1021%2fja011790v&partnerID=40&md5=5667753f094fa501e1aa63b8e772dd38}, doi = {10.1021/ja011790v}, year = {2002}, date = {2002-01-01}, journal = {Journal of the American Chemical Society}, volume = {124}, number = {15}, pages = {4050--4057}, abstract = {A method is described to determine long-range cross-correlations between the modulations of an anisotropic chemical shift (e.g., of a C′ carbonyl carbon in a protein) and the fluctuations of a weak long-range dipolar interaction (e.g., in cross-correlation between the same C′ carbonyl and the HN proton of the neighboring amide group). Such long-range correlations are difficult to measure because the corresponding long-range scalar couplings are so small that Redfield's secular approximation is often violated. The method, which combines features of single- and double-quantum NMR spectroscopy, allows one to cancel the effects of dominant short-range dipolar interactions (e.g., between the CSA of the amide nitrogen N and the dipolar coupling to its attached proton HN) and is designed so that the secular approximation is rescued even if the scalar coupling between the long-range dipolar coupling partners is very small. The cross-correlation rates thus determined in ubiquitin cover a wide range because of local motions and variations of the CSA tensors.}, keywords = {}, pubstate = {published}, tppubtype = {article} } A method is described to determine long-range cross-correlations between the modulations of an anisotropic chemical shift (e.g., of a C′ carbonyl carbon in a protein) and the fluctuations of a weak long-range dipolar interaction (e.g., in cross-correlation between the same C′ carbonyl and the HN proton of the neighboring amide group). Such long-range correlations are difficult to measure because the corresponding long-range scalar couplings are so small that Redfield's secular approximation is often violated. The method, which combines features of single- and double-quantum NMR spectroscopy, allows one to cancel the effects of dominant short-range dipolar interactions (e.g., between the CSA of the amide nitrogen N and the dipolar coupling to its attached proton HN) and is designed so that the secular approximation is rescued even if the scalar coupling between the long-range dipolar coupling partners is very small. The cross-correlation rates thus determined in ubiquitin cover a wide range because of local motions and variations of the CSA tensors. |
2001 |
Cross-correlated chemical shift modulation: A signature of slow internal motions in proteins Article de journal D Früh; J R Tolman; G Bodenhausen; C Zwahlen Journal of the American Chemical Society, 123 (20), p. 4810–4816, 2001. @article{Fruh:2001, title = {Cross-correlated chemical shift modulation: A signature of slow internal motions in proteins}, author = {D Fr\"{u}h and J R Tolman and G Bodenhausen and C Zwahlen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0034821018&doi=10.1021%2fja003487k&partnerID=40&md5=4f1e234d2cd3e15aff36555ba9601525}, doi = {10.1021/ja003487k}, year = {2001}, date = {2001-01-01}, journal = {Journal of the American Chemical Society}, volume = {123}, number = {20}, pages = {4810--4816}, abstract = {A novel NMR experiment allows one to characterize slow motion in macromolecules. The method exploits the fact that motions, such as rotation about dihedral angles, induce correlated fluctuations of the isotropic chemical shifts of the nuclei in the vicinity. The relaxation of two-spin coherences involving Cα and Cβ nuclei in proteins provides information about correlated fluctuations of the isotropic chemical shifts of Cα and Cβ. The difference between the relaxation rates of double- and zero-quantum coherences C+α C+β and C+α C-β is shown to be affected by cross-correlated chemical shift modulation. In ubiquitin, evidence for slow motion is found in loops or near the ends of β-strands and α-helices.}, keywords = {}, pubstate = {published}, tppubtype = {article} } A novel NMR experiment allows one to characterize slow motion in macromolecules. The method exploits the fact that motions, such as rotation about dihedral angles, induce correlated fluctuations of the isotropic chemical shifts of the nuclei in the vicinity. The relaxation of two-spin coherences involving Cα and Cβ nuclei in proteins provides information about correlated fluctuations of the isotropic chemical shifts of Cα and Cβ. The difference between the relaxation rates of double- and zero-quantum coherences C+α C+β and C+α C-β is shown to be affected by cross-correlated chemical shift modulation. In ubiquitin, evidence for slow motion is found in loops or near the ends of β-strands and α-helices. |
Anisotropy of rotational diffusion, dipole - Dipole cross-correlated NMR relaxation and angles between bond vectors in proteins Article de journal M Deschamps; G Bodenhausen ChemPhysChem, 2 (8-9), p. 539–543, 2001. @article{Deschamps:2001, title = {Anisotropy of rotational diffusion, dipole - Dipole cross-correlated NMR relaxation and angles between bond vectors in proteins}, author = {M Deschamps and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0035903259&partnerID=40&md5=b186bce1871f0c4beaf28cca875ae8d0}, year = {2001}, date = {2001-01-01}, journal = {ChemPhysChem}, volume = {2}, number = {8-9}, pages = {539--543}, keywords = {}, pubstate = {published}, tppubtype = {article} } |
Hydrogen bonds in RNA base pairs investigated by cross-correlated relaxation of multiple-quantum coherence in NMR Article de journal E Chiarparin; S Rüdisser; G Bodenhausen ChemPhysChem, 2 (1), p. 41–45, 2001. @article{Chiarparin:2001, title = {Hydrogen bonds in RNA base pairs investigated by cross-correlated relaxation of multiple-quantum coherence in NMR}, author = {E Chiarparin and S R\"{u}disser and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0001935794&doi=10.1002%2f1439-7641%2820010119%292%3a1%3c41%3a%3aAID-CPHC41%3e3.0.CO%3b2-H&partnerID=40&md5=2c60dab657b1481ccc61e8c18bb9a274}, doi = {10.1002/1439-7641(20010119)2:1<41::AID-CPHC41>3.0.CO;2-H}, year = {2001}, date = {2001-01-01}, journal = {ChemPhysChem}, volume = {2}, number = {1}, pages = {41--45}, keywords = {}, pubstate = {published}, tppubtype = {article} } |
Probing aerogels by multiple quantum filtered 131Xe NMR spectroscopy Article de journal T Meersmann; M Deschamps; G Bodenhausen Journal of the American Chemical Society, 123 (5), p. 941–945, 2001. @article{Meersmann:2001, title = {Probing aerogels by multiple quantum filtered 131Xe NMR spectroscopy}, author = {T Meersmann and M Deschamps and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0035819627&doi=10.1021%2fja002747v&partnerID=40&md5=c9e1a9bf9a6abe6257c51110b89b0aa3}, doi = {10.1021/ja002747v}, year = {2001}, date = {2001-01-01}, journal = {Journal of the American Chemical Society}, volume = {123}, number = {5}, pages = {941--945}, abstract = {At the interface between solid surfaces and cavities filled with gaseous or liquid xenon, the nuclear magnetization of 131Xe (S = 3/2) is subject to quadrupolar interactions which may lead to higher rank single-quantum coherences that can be described by tensor elements T2,±1 and T3,±1. This can be demonstrated by multiple-quantum filtered (MQF) NMR experiments. In gaseous xenon on Pyrex surfaces, the primary source of such coherences was shown to be coherent evolution induced by a nonvanishing average quadrupolar coupling. In this contribution, MQF NMR is applied to aerogels filled with liquid xenon to demonstrate the potential of this technique for material sciences. Xenon in the liquid phase provides a sufficient spin density to obtain reasonable signal-to-noise ratios. Coherent evolution and relaxation both contribute to the creation of higher rank coherences depending on the presence or absence of water molecules on the surface. These two processes can be distinguished experimentally and provide complementary information about the surface of the host material.}, keywords = {}, pubstate = {published}, tppubtype = {article} } At the interface between solid surfaces and cavities filled with gaseous or liquid xenon, the nuclear magnetization of 131Xe (S = 3/2) is subject to quadrupolar interactions which may lead to higher rank single-quantum coherences that can be described by tensor elements T2,±1 and T3,±1. This can be demonstrated by multiple-quantum filtered (MQF) NMR experiments. In gaseous xenon on Pyrex surfaces, the primary source of such coherences was shown to be coherent evolution induced by a nonvanishing average quadrupolar coupling. In this contribution, MQF NMR is applied to aerogels filled with liquid xenon to demonstrate the potential of this technique for material sciences. Xenon in the liquid phase provides a sufficient spin density to obtain reasonable signal-to-noise ratios. Coherent evolution and relaxation both contribute to the creation of higher rank coherences depending on the presence or absence of water molecules on the surface. These two processes can be distinguished experimentally and provide complementary information about the surface of the host material. |
2000 |
Coherence transfer by single-transition cross-polarization: quantitation of cross-correlation effects in nuclear magnetic resonance Article de journal F Ferrage; T R Eykyn; G Bodenhausen Journal of Chemical Physics, 113 (3), p. 1081–1087, 2000. @article{Ferrage:2000, title = {Coherence transfer by single-transition cross-polarization: quantitation of cross-correlation effects in nuclear magnetic resonance}, author = {F Ferrage and T R Eykyn and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0034229257&doi=10.1063%2f1.481958&partnerID=40&md5=ee6ea9fd6547a382a516fbf30e871949}, doi = {10.1063/1.481958}, year = {2000}, date = {2000-01-01}, journal = {Journal of Chemical Physics}, volume = {113}, number = {3}, pages = {1081--1087}, abstract = {A study was carried out to demonstrate the possibility of transferring coherence by selective cross-polarization between two transitions in a four-level system consisting of scalar coupled spins I = 1/2 and S = 1/2 in isotropic solution. Cross-polarization provided the selectivity to confine the evolution of the single-transition coherence within two mutually exclusive subspaces of the Liouville space.}, keywords = {}, pubstate = {published}, tppubtype = {article} } A study was carried out to demonstrate the possibility of transferring coherence by selective cross-polarization between two transitions in a four-level system consisting of scalar coupled spins I = 1/2 and S = 1/2 in isotropic solution. Cross-polarization provided the selectivity to confine the evolution of the single-transition coherence within two mutually exclusive subspaces of the Liouville space. |
Single-transition coherence transfer by adiabatic cross polarization in NMR Article de journal T R Eykyn; F Ferrage; E Winterfors; G Bodenhausen ChemPhysChem, 1 (4), p. 217–221, 2000. @article{Eykyn:2000, title = {Single-transition coherence transfer by adiabatic cross polarization in NMR}, author = {T R Eykyn and F Ferrage and E Winterfors and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0000511343&partnerID=40&md5=f3592a241ff561508eeb7f9082d7beef}, year = {2000}, date = {2000-01-01}, journal = {ChemPhysChem}, volume = {1}, number = {4}, pages = {217--221}, keywords = {}, pubstate = {published}, tppubtype = {article} } |
Measurement of radiation damping rate constants in nuclear magnetic resonance by inversion recovery and automated compensation of selective pulses Article de journal J -H Chen; B Cutting; G Bodenhausen Journal of Chemical Physics, 112 (15), p. 6511–6514, 2000. @article{Chen:2000, title = {Measurement of radiation damping rate constants in nuclear magnetic resonance by inversion recovery and automated compensation of selective pulses}, author = {J -H Chen and B Cutting and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0000535456&doi=10.1063%2f1.481223&partnerID=40&md5=849753d9d4ac10957ffd8e24106c6961}, doi = {10.1063/1.481223}, year = {2000}, date = {2000-01-01}, journal = {Journal of Chemical Physics}, volume = {112}, number = {15}, pages = {6511--6514}, abstract = {A method is proposed to measure the radiation damping rate constant based on the analysis of the nonexponential recovery of the magnetization after inversion. It is applicable when the recovery is dominated by radiation damping rather than by relaxation processes. The accurate measurement of the radiation damping rate constant can be used to simplify a recent method for the compensation of radiation damping effects during the application of selective pulses [Chen, Jerschow, and Bodenhausen, Chem. Phys. Lett. 308, 397 (1999)]. This procedure can now be automated, as illustrated by applications to selective inversion and excitation. © 2000 American Institute of Physics.}, keywords = {}, pubstate = {published}, tppubtype = {article} } A method is proposed to measure the radiation damping rate constant based on the analysis of the nonexponential recovery of the magnetization after inversion. It is applicable when the recovery is dominated by radiation damping rather than by relaxation processes. The accurate measurement of the radiation damping rate constant can be used to simplify a recent method for the compensation of radiation damping effects during the application of selective pulses [Chen, Jerschow, and Bodenhausen, Chem. Phys. Lett. 308, 397 (1999)]. This procedure can now be automated, as illustrated by applications to selective inversion and excitation. © 2000 American Institute of Physics. |
Nuclear magnetic resonance study of xenon-131 interacting with surfaces: effective Liouvillian and spectral analysis Article de journal M Deschamps; I Burghardt; C Derouet; G Bodenhausen; D Belkić Journal of Chemical Physics, 113 (4), p. 1630–1640, 2000. @article{Deschamps:2000, title = {Nuclear magnetic resonance study of xenon-131 interacting with surfaces: effective Liouvillian and spectral analysis}, author = {M Deschamps and I Burghardt and C Derouet and G Bodenhausen and D Belki\'{c}}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0034228329&doi=10.1063%2f1.481951&partnerID=40&md5=6edacb8aacc68f7f1263b21a6dcf427a}, doi = {10.1063/1.481951}, year = {2000}, date = {2000-01-01}, journal = {Journal of Chemical Physics}, volume = {113}, number = {4}, pages = {1630--1640}, abstract = {The nuclear spin dynamics of xenon-131 induced by transient adsorption at surfaces were analytically studied. The possibility of determining the complex eigenvalues of the effective Liouvillian was demonstrated. Further, the results of this study were compared with those of a conventional fit procedure, and with the determination of spectral poles using rational-fraction extrapolation to complex frequencies.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The nuclear spin dynamics of xenon-131 induced by transient adsorption at surfaces were analytically studied. The possibility of determining the complex eigenvalues of the effective Liouvillian was demonstrated. Further, the results of this study were compared with those of a conventional fit procedure, and with the determination of spectral poles using rational-fraction extrapolation to complex frequencies. |
Relative orientation of C(α)Ħ(α)-bond vectors of successive residues in proteins through cross-correlated relaxation in NMR Article de journal E Chiarparin; P Pelupessy; R Ghose; G Bodenhausen Journal of the American Chemical Society, 122 (8), p. 1758–1761, 2000. @article{Chiarparin:2000, title = {Relative orientation of C(α){H}(α)-bond vectors of successive residues in proteins through cross-correlated relaxation in NMR}, author = {E Chiarparin and P Pelupessy and R Ghose and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0034090655&doi=10.1021%2fja9933184&partnerID=40&md5=e9e0149fa4eabd072368d730fc09acce}, doi = {10.1021/ja9933184}, year = {2000}, date = {2000-01-01}, journal = {Journal of the American Chemical Society}, volume = {122}, number = {8}, pages = {1758--1761}, abstract = {Cross-correlation between the fluctuations of 13C(α)-H(α) interactions affects the relaxation behavior of two-spin coherences (zero- and double-quantum coherences) involving the 13C(α) nuclei of two successive amino acid residues. The cross-correlation rates are shown to depend on a dihedral angle Σ defined by two planes subtended by the atoms H(α)(i-l),13C(α)(i-l),13(α)C(i) and 13C(α)(i- l),13C(α)(i),H(α)(i). This dihedral angle is related to the secondary structure of a protein, and can be used as a constraint in various protein structure calculation protocols.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Cross-correlation between the fluctuations of 13C(α)-H(α) interactions affects the relaxation behavior of two-spin coherences (zero- and double-quantum coherences) involving the 13C(α) nuclei of two successive amino acid residues. The cross-correlation rates are shown to depend on a dihedral angle Σ defined by two planes subtended by the atoms H(α)(i-l),13C(α)(i-l),13(α)C(i) and 13C(α)(i- l),13C(α)(i),H(α)(i). This dihedral angle is related to the secondary structure of a protein, and can be used as a constraint in various protein structure calculation protocols. |
1999 |
Simultaneous determination of Ψ and Φ angles in proteins from measurements of cross-correlated relaxation effects Article de journal P Pelupessy; E Chiarparin; R Ghose; G Bodenhausen Journal of Biomolecular NMR, 14 (3), p. 277–280, 1999. @article{Pelupessy:1999a, title = {Simultaneous determination of Ψ and Φ angles in proteins from measurements of cross-correlated relaxation effects}, author = {P Pelupessy and E Chiarparin and R Ghose and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0032821088&doi=10.1023%2fA%3a1008339928400&partnerID=40&md5=cb11bb12caa260ca301496001d2c7e49}, doi = {10.1023/A:1008339928400}, year = {1999}, date = {1999-01-01}, journal = {Journal of Biomolecular NMR}, volume = {14}, number = {3}, pages = {277--280}, abstract = {A method is presented to determine both Φ and Ψ backbone angles in proteins simultaneously. This is achieved by measuring the effect on two-spin coherences of cross-correlation between 15N-1H(N) and 13C(α)-1H(α) vectors. The cross-correlation rates are obtained by comparing two complementary three-dimensional experiments.}, keywords = {}, pubstate = {published}, tppubtype = {article} } A method is presented to determine both Φ and Ψ backbone angles in proteins simultaneously. This is achieved by measuring the effect on two-spin coherences of cross-correlation between 15N-1H(N) and 13C(α)-1H(α) vectors. The cross-correlation rates are obtained by comparing two complementary three-dimensional experiments. |
Relaxation of two-spin coherence due to cross-correlated fluctuations of dipole-dipole couplings and anisotropic shifts in NMR of 15N,13C-labeled biomolecules Article de journal E Chiarparin; P Pelupessy; R Ghose; G Bodenhausen Journal of the American Chemical Society, 121 (29), p. 6876–6883, 1999. @article{Chiarparin:1999a, title = {Relaxation of two-spin coherence due to cross-correlated fluctuations of dipole-dipole couplings and anisotropic shifts in NMR of 15N,13C-labeled biomolecules}, author = {E Chiarparin and P Pelupessy and R Ghose and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0033612728&doi=10.1021%2fja984390p&partnerID=40&md5=52b5e2dc3356aaa979f8f98c57d88820}, doi = {10.1021/ja984390p}, year = {1999}, date = {1999-01-01}, journal = {Journal of the American Chemical Society}, volume = {121}, number = {29}, pages = {6876--6883}, abstract = {A comprehensive description is presented of the effects on two-spin coherences (i.e., superpositions of zero- and double-quantum coherences) of cross-correlation between the fluctuations of two different relaxation mechanisms in nuclear magnetic resonance (NMR). Dipole-dipole (DD) interactions between four nuclei and chemical shift anisotropy (CSA) of two of these nuclei are considered. Two complementary experiments have been designed for 15N,13C-labeled proteins to quantify the effects of cross- correlation between the 13C(α)-1Hα and 15N-1H(N) dipolar interactions on two-spin coherences involving 13C(α) of the ith residue with the 15N of the (i+1)th amino acid. Two other experiments allow one to quantify the effect of cross-correlation between the 13C' (carbonyl) CSA and the 13C(α)-1H(α) dipolar coupling on the relaxation of two-spin coherences involving the 13C' and 13C(α) nuclei on the same residue of the protein. These experiments have been used to extract relevant cross-correlation rates in 15N,13C-labeled human ubiquitin. These rates show a high degree of correlation with the backbone Ψ angles in proteins.}, keywords = {}, pubstate = {published}, tppubtype = {article} } A comprehensive description is presented of the effects on two-spin coherences (i.e., superpositions of zero- and double-quantum coherences) of cross-correlation between the fluctuations of two different relaxation mechanisms in nuclear magnetic resonance (NMR). Dipole-dipole (DD) interactions between four nuclei and chemical shift anisotropy (CSA) of two of these nuclei are considered. Two complementary experiments have been designed for 15N,13C-labeled proteins to quantify the effects of cross- correlation between the 13C(α)-1Hα and 15N-1H(N) dipolar interactions on two-spin coherences involving 13C(α) of the ith residue with the 15N of the (i+1)th amino acid. Two other experiments allow one to quantify the effect of cross-correlation between the 13C' (carbonyl) CSA and the 13C(α)-1H(α) dipolar coupling on the relaxation of two-spin coherences involving the 13C' and 13C(α) nuclei on the same residue of the protein. These experiments have been used to extract relevant cross-correlation rates in 15N,13C-labeled human ubiquitin. These rates show a high degree of correlation with the backbone Ψ angles in proteins. |
Tilt Angle Dependence of Cross-Relaxation in Off-Resonance ROESY Article de journal B Cutting; R Ghose; G Bodenhausen Journal of Magnetic Resonance, 138 (2), p. 326–329, 1999. @article{Cutting:1999a, title = {Tilt Angle Dependence of Cross-Relaxation in Off-Resonance ROESY}, author = {B Cutting and R Ghose and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0033145213&doi=10.1006%2fjmre.1999.1734&partnerID=40&md5=c51297eccf885a6aba65f8fca5031666}, doi = {10.1006/jmre.1999.1734}, year = {1999}, date = {1999-01-01}, journal = {Journal of Magnetic Resonance}, volume = {138}, number = {2}, pages = {326--329}, abstract = {We present an efficient experimental method to evaluate whether the effective cross-relaxation rate between a pair of spins vanishes when applying an off-resonance spin-lock field. It is shown that the cross-relaxation rate can be made to vanish even when the two spins concerned resonate at different offsets and experience significantly different tilt angles of their respective spin-lock fields. This is verified experimentally using a sample of 15N-labeled human ubiquitin, through selective excitation of chosen amide protons. The results are relevant for the quantitative interpretation of off-resonance ROESY experiments. © 1999 Academic Press.}, keywords = {}, pubstate = {published}, tppubtype = {article} } We present an efficient experimental method to evaluate whether the effective cross-relaxation rate between a pair of spins vanishes when applying an off-resonance spin-lock field. It is shown that the cross-relaxation rate can be made to vanish even when the two spins concerned resonate at different offsets and experience significantly different tilt angles of their respective spin-lock fields. This is verified experimentally using a sample of 15N-labeled human ubiquitin, through selective excitation of chosen amide protons. The results are relevant for the quantitative interpretation of off-resonance ROESY experiments. © 1999 Academic Press. |
Attenuation of Cross-Peak Intensities in QUIET-BIRD-NOESY Experiments Article de journal B Cutting; G Bodenhausen Journal of Magnetic Resonance, 140 (1), p. 289–292, 1999. @article{Cutting:1999, title = {Attenuation of Cross-Peak Intensities in QUIET-BIRD-NOESY Experiments}, author = {B Cutting and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0033185638&doi=10.1006%2fjmre.1999.1848&partnerID=40&md5=c3c43a9b59da58edb72929a2e8b69b49}, doi = {10.1006/jmre.1999.1848}, year = {1999}, date = {1999-01-01}, journal = {Journal of Magnetic Resonance}, volume = {140}, number = {1}, pages = {289--292}, abstract = {The buildup curves in QUIET-BIRD-NOESY experiments, which are designed to isolate two-spin subsystems within macromolecules, are attenuated by transverse relaxation and evolution under homonuclear couplings during the bilinear rotation decoupling (BIRD) pulse sandwich. If the signals of both source and target spins are attenuated equally (uniform damping), this is readily accounted for by normalizing the cross peaks with respect to the diagonal peaks. However, unequal attenuation of source and target spins (differential damping) affects the initial buildup slopes and hence leads to apparent cross-relaxation rates that are significantly distorted from their true values. A simple method for recognizing this situation and extracting accurate cross-relaxation rates is presented. © 1999 Academic Press.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The buildup curves in QUIET-BIRD-NOESY experiments, which are designed to isolate two-spin subsystems within macromolecules, are attenuated by transverse relaxation and evolution under homonuclear couplings during the bilinear rotation decoupling (BIRD) pulse sandwich. If the signals of both source and target spins are attenuated equally (uniform damping), this is readily accounted for by normalizing the cross peaks with respect to the diagonal peaks. However, unequal attenuation of source and target spins (differential damping) affects the initial buildup slopes and hence leads to apparent cross-relaxation rates that are significantly distorted from their true values. A simple method for recognizing this situation and extracting accurate cross-relaxation rates is presented. © 1999 Academic Press. |
Determination of Coupling Constants by Deconvolution of Multiplets in NMR Article de journal D Jeannerat; G Bodenhausen Journal of Magnetic Resonance, 141 (1), p. 133–140, 1999. @article{Jeannerat:1999, title = {Determination of Coupling Constants by Deconvolution of Multiplets in NMR}, author = {D Jeannerat and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0000048341&doi=10.1006%2fjmre.1999.1845&partnerID=40&md5=69fac8db48b3cca2d5304c1380377c4e}, doi = {10.1006/jmre.1999.1845}, year = {1999}, date = {1999-01-01}, journal = {Journal of Magnetic Resonance}, volume = {141}, number = {1}, pages = {133--140}, abstract = {The structures of multiplets in one- and two-dimensional NMR spectra can be simplified by recursive deconvolution in the frequency domain. Deconvolution procedures are described for inphase and antiphase doublets of delta functions. Recursive simplification is illustrated by applications to double-quantum-filtered correlation spectra (DQF-COSY) and selective correlation spectra (soft-COSY). Coupling constants can be measured reliably even if signals of opposite signs lead to partial cancellation. © 1999 Academic Press.}, keywords = {}, pubstate = {published}, tppubtype = {article} } The structures of multiplets in one- and two-dimensional NMR spectra can be simplified by recursive deconvolution in the frequency domain. Deconvolution procedures are described for inphase and antiphase doublets of delta functions. Recursive simplification is illustrated by applications to double-quantum-filtered correlation spectra (DQF-COSY) and selective correlation spectra (soft-COSY). Coupling constants can be measured reliably even if signals of opposite signs lead to partial cancellation. © 1999 Academic Press. |
Determination of internuclear distances by suppressing spin diffusion in rotating-frame overhauser measurements Article de journal S J F Vincent; G Bodenhausen Applied Magnetic Resonance, 17 (2-3), p. 189–196, 1999. @article{Vincent:1999, title = {Determination of internuclear distances by suppressing spin diffusion in rotating-frame overhauser measurements}, author = {S J F Vincent and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0033264645&doi=10.1007%2fBF03162160&partnerID=40&md5=d62e4f4f2a9a0b971a96f47d2605db58}, doi = {10.1007/BF03162160}, year = {1999}, date = {1999-01-01}, journal = {Applied Magnetic Resonance}, volume = {17}, number = {2-3}, pages = {189--196}, abstract = {In off-resonance rotating-frame Overhauser spectroscopy (OFF-ROESY), spin-diffusion effects can be suppressed in selected spectral regions by doubly-selective inversion of the magnetization in the middle of the cross-relaxation interval. The resulting "quenching of undesirable indirect external trouble in off-resonance rotating-frame Overhauser effect spectroscopy" (QUIET-OFF-ROESY) experiment yields direct information about cross-relaxation rates between selected pairs of spins, as if the two-spin subsystems were isolated from their surroundings. When the cross-relaxation rates of a macromolecule are observed under spin-locked conditions with an effective field tilted by an angle 35.3° textless θ textless 90° with respect to the z-axis of the rotating frame, the intensity of cross-peaks may be increased if contributions due to spin diffusion are suppressed. Applications to a desoxyribonucleic acid dodecamer demonstrate that the precision of the determination of internuclear distances can be significantly improved if spin diffusion is quenched. © Springer-Verlag 1999 Printed in Austria.}, keywords = {}, pubstate = {published}, tppubtype = {article} } In off-resonance rotating-frame Overhauser spectroscopy (OFF-ROESY), spin-diffusion effects can be suppressed in selected spectral regions by doubly-selective inversion of the magnetization in the middle of the cross-relaxation interval. The resulting "quenching of undesirable indirect external trouble in off-resonance rotating-frame Overhauser effect spectroscopy" (QUIET-OFF-ROESY) experiment yields direct information about cross-relaxation rates between selected pairs of spins, as if the two-spin subsystems were isolated from their surroundings. When the cross-relaxation rates of a macromolecule are observed under spin-locked conditions with an effective field tilted by an angle 35.3° textless θ textless 90° with respect to the z-axis of the rotating frame, the intensity of cross-peaks may be increased if contributions due to spin diffusion are suppressed. Applications to a desoxyribonucleic acid dodecamer demonstrate that the precision of the determination of internuclear distances can be significantly improved if spin diffusion is quenched. © Springer-Verlag 1999 Printed in Austria. |
Identification of Spin Diffusion Pathways in Isotopically Labeled Biomolecules Article de journal T R Eykyn; D Früh; G Bodenhausen Journal of Magnetic Resonance, 138 (2), p. 330–333, 1999. @article{Eykyn:1999, title = {Identification of Spin Diffusion Pathways in Isotopically Labeled Biomolecules}, author = {T R Eykyn and D Fr\"{u}h and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0033144287&doi=10.1006%2fjmre.1999.1736&partnerID=40&md5=3d120a38f25e1bda07ff7314d32acc20}, doi = {10.1006/jmre.1999.1736}, year = {1999}, date = {1999-01-01}, journal = {Journal of Magnetic Resonance}, volume = {138}, number = {2}, pages = {330--333}, abstract = {One-dimensional NOE experiments applicable to labeled macromolecules are presented which allow the manipulation of specific spin diffusion pathways and thus unambiguously identify clandestine spins through which the direct NOE is mediated. A treatment of spin diffusion using average Liouvillian theory is shown to describe adequately these phenomena. Experiments are carried out on an 15N-labeled sample of human ubiquitin. © 1999 Academic Press.}, keywords = {}, pubstate = {published}, tppubtype = {article} } One-dimensional NOE experiments applicable to labeled macromolecules are presented which allow the manipulation of specific spin diffusion pathways and thus unambiguously identify clandestine spins through which the direct NOE is mediated. A treatment of spin diffusion using average Liouvillian theory is shown to describe adequately these phenomena. Experiments are carried out on an 15N-labeled sample of human ubiquitin. © 1999 Academic Press. |
Excitation of Selected Proton Signals in NMR of Isotopically Labeled Macromolecules Article de journal P Pelupessy; E Chiarparin; G Bodenhausen Journal of Magnetic Resonance, 138 (1), p. 178–181, 1999. @article{Pelupessy:1999, title = {Excitation of Selected Proton Signals in NMR of Isotopically Labeled Macromolecules}, author = {P Pelupessy and E Chiarparin and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0001210058&doi=10.1006%2fjmre.1999.1715&partnerID=40&md5=b2c12f83a69de9bc63b543499a8b34e3}, doi = {10.1006/jmre.1999.1715}, year = {1999}, date = {1999-01-01}, journal = {Journal of Magnetic Resonance}, volume = {138}, number = {1}, pages = {178--181}, abstract = {In isotopically labeled macromolecules, it is possible to excite the signal of a selected proton by shuttling magnetization back and forth between the chosen proton and a heteronucleus such as 13C or 15N, using two-way doubly selective heteronuclear cross-polarization. Selective excitation of a chosen proton can be followed by homonuclear coherence transfer to identify side-chain resonances of the corresponding amino acid in proteins. The resulting one-dimensional experiments yield information that can usually only be obtained from three-dimensional HSQC-TOCSY spectra. The method also provides efficient suppression of solvent signals without affecting resonances close to the solvent peak. © 1999 Academic Press.}, keywords = {}, pubstate = {published}, tppubtype = {article} } In isotopically labeled macromolecules, it is possible to excite the signal of a selected proton by shuttling magnetization back and forth between the chosen proton and a heteronucleus such as 13C or 15N, using two-way doubly selective heteronuclear cross-polarization. Selective excitation of a chosen proton can be followed by homonuclear coherence transfer to identify side-chain resonances of the corresponding amino acid in proteins. The resulting one-dimensional experiments yield information that can usually only be obtained from three-dimensional HSQC-TOCSY spectra. The method also provides efficient suppression of solvent signals without affecting resonances close to the solvent peak. © 1999 Academic Press. |
Measurement of Relaxation Rates of NH and Hα Backbone Protons in Proteins with Tailored Initial Conditions Article de journal O Millet; E Chiarparin; P Pelupessy; M Pons; G Bodenhausen Journal of Magnetic Resonance, 139 (2), p. 434–438, 1999. @article{Millet:1999, title = {Measurement of Relaxation Rates of NH and Hα Backbone Protons in Proteins with Tailored Initial Conditions}, author = {O Millet and E Chiarparin and P Pelupessy and M Pons and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0033170454&doi=10.1006%2fjmre.1999.1815&partnerID=40&md5=712e47ec489a98682b0ab0468b2cb5ab}, doi = {10.1006/jmre.1999.1815}, year = {1999}, date = {1999-01-01}, journal = {Journal of Magnetic Resonance}, volume = {139}, number = {2}, pages = {434--438}, abstract = {Several methods are presented for the selective determination of spin-lattice and spin-spin relaxation rates of backbone protons in labeled proteins. The relaxation rates of amide protons in 15N labeled proteins can be measured by using two-way selective cross-polarization (SCP). The measurement of Hα relaxation rates can be achieved by combining this method with homonuclear Hartmann-Hahn transfer using doubly selective irradiation. Various schemes for selective or nonselective inversion of the longitudinal proton magnetization lead to different initial recovery rates. The methods have been applied to lysine K6 in 15N-labeled human ubiquitin and to leucine L5 in 15N- and 13C-labeled octapeptide YG*G*F*LRRI (GFL) in which the marked residues are 15N- and 13C-labeled. © 1999 Academic Press.}, keywords = {}, pubstate = {published}, tppubtype = {article} } Several methods are presented for the selective determination of spin-lattice and spin-spin relaxation rates of backbone protons in labeled proteins. The relaxation rates of amide protons in 15N labeled proteins can be measured by using two-way selective cross-polarization (SCP). The measurement of Hα relaxation rates can be achieved by combining this method with homonuclear Hartmann-Hahn transfer using doubly selective irradiation. Various schemes for selective or nonselective inversion of the longitudinal proton magnetization lead to different initial recovery rates. The methods have been applied to lysine K6 in 15N-labeled human ubiquitin and to leucine L5 in 15N- and 13C-labeled octapeptide YG*G*F*LRRI (GFL) in which the marked residues are 15N- and 13C-labeled. © 1999 Academic Press. |
Mapping the B1 Field Distribution with Nonideal Gradients in a High-Resolution NMR Spectrometer Article de journal A Jerschow; G Bodenhausen Journal of Magnetic Resonance, 137 (1), p. 108–115, 1999. @article{Jerschow:1999, title = {Mapping the B1 Field Distribution with Nonideal Gradients in a High-Resolution NMR Spectrometer}, author = {A Jerschow and G Bodenhausen}, url = {https://www.scopus.com/inward/record.uri?eid=2-s2.0-0033090222&doi=10.1006%2fjmre.1998.1645&partnerID=40&md5=e90084df670d50839830af59748775f9}, doi = {10.1006/jmre.1998.1645}, year = {1999}, date = {1999-01-01}, journal = {Journal of Magnetic Resonance}, volume = {137}, number = {1}, pages = {108--115}, abstract = {To understand the behavior of many NMR experiments, it is important to determine the spatial distribution of the B1 field. In this paper, we show how this distribution can be mapped independently of spin density, coil responsiveness, and nonlinearities of the B0 field gradients. As a by-product we obtain a map of the (possibly nonlinear) spatial variation of the B0 field gradients used in the imaging procedure. © 1999 Academic Press.}, keywords = {}, pubstate = {published}, tppubtype = {article} } To understand the behavior of many NMR experiments, it is important to determine the spatial distribution of the B1 field. In this paper, we show how this distribution can be mapped independently of spin density, coil responsiveness, and nonlinearities of the B0 field gradients. As a by-product we obtain a map of the (possibly nonlinear) spatial variation of the B0 field gradients used in the imaging procedure. © 1999 Academic Press. |